rburns@teknowledge-vaxc.UUCP (03/27/87)
I was wondering roughly how many 'bytes' of information are contained within human chromosomes?
werner@aecom.UUCP (03/28/87)
In article <11189@teknowledge-vaxc.ARPA>, rburns@teknowledge-vaxc.ARPA (Randy Burns) writes: > I was wondering roughly how many 'bytes' of information are contained > within human chromosomes? The human genome contain 3 * 10^9 base pairs, which is 1000 times as much as that of Escherichia coli, and about 300 times the total of all published sequences to date (*). Much of that is repeated DNA, either satellite DNA, interspersed repeats, or moderately repeated gene families (like ribosomal RNA). Hence, if a byte is a base pair, that's your answer, although only two bits are required to specify a base, ergo a 'byte' could actually be a tetranucleotide, but most sequences are stored as letters (ATCG). Similarly, if information is the key phrase here, only about 10-20% of the genome encodes information, so that brings the total storage requirements down from 3000 Mbp to 300-600Mbp, maybe even less. (*) Latest release of Genbank contains 10,913 sequences from 13,774 publications, totalling 10,961,365 base pairs. -- Craig Werner (MD/PhD '91) !philabs!aecom!werner (1935-14E Eastchester Rd., Bronx NY 10461, 212-931-2517) "Viruses do to cells what Groucho did to Freedonia."
srp@ethz.UUCP (03/29/87)
In article <11189@teknowledge-vaxc.ARPA> rburns@teknowledge-vaxc.UUCP writes: >I was wondering roughly how many 'bytes' of information are contained >within human chromosomes? This assumes one base-pair is one bit. Number of basepairs in the human genome = 2,900,000,000 = 2.9 giga-_bits_ = 362.5 mega-bytes (Assuming 1000 base-pairs per gene = 2.9 mega-genes) Doesn't seem like much does it? A vast majority of these 'bytes' aren't even part of a gene or control region. These numbers come from the combination of my calculator and the book... "DNA Replication" by Arthur Kornberg" W.H. Freeman and Co.(1980) pg 20. -- ----------- Scott Presnell Swiss Federal Institute of Technology (ETH-Zentrum) Department of Organic Chemistry Universitaetsstrasse 16 CH-8092 Zurich Switzerland. uucp: ...seismo!mcvax!cernvax!ethz!srp (srp@ethz.uucp) earn/bitnet: Benner@CZHETH5A
agranok@udenva.UUCP (03/29/87)
In article <978@aecom.UUCP> werner@aecom.UUCP (Craig Werner) writes: >In article <11189@teknowledge-vaxc.ARPA>, rburns@teknowledge-vaxc.ARPA (Randy Burns) writes: >> I was wondering roughly how many 'bytes' of information are contained >> within human chromosomes? > > Hence, if a byte is a base pair, that's your answer, although >only two bits are required to specify a base, ergo a 'byte' could >actually be a tetranucleotide, but most sequences are stored as >letters (ATCG). The whole arguement gets caught up in definitions, here. I would consider a bit to be a base pair, and a byte to be the set of three that encodes for one amino acid. Instead of eight bits to a byte, there are three. After all, one base pair by itself doesn't do much good. But, if a base pair is a bit, then what is a nucleotide? I guess it all depends on what you mean by "informa- tion." That's the problem with trying to put restrictions from one system onto another. I think a better question might be something like: "How many amino acids (words in the language of proteins) are encoded for on the human chromosomes?" or "How many books could these words fill?" I seem to remember Sagan doing something like this on Cosmos. Anyway, I think that would give a much more easily palpable idea for the enormity of information involved. -- Alex Granok hao!udenva!agranok "Wait a minute. Strike that. Reverse it."
emigh@ecsvax.UUCP (03/30/87)
In article <3310@udenva.UUCP> agranok@udenva.UUCP (Alexander Granok) writes: >(Craig Werner) writes: >>(Randy Burns) writes: >>> I was wondering roughly how many 'bytes' of information are contained >>> within human chromosomes? >> Hence, if a byte is a base pair, that's your answer, although >>only two bits are required to specify a base, ergo a 'byte' could >>actually be a tetranucleotide, but most sequences are stored as >>letters (ATCG). >The whole arguement gets caught up in definitions, here. I would consider a >bit to be a base pair, and a byte to be the set of three that encodes for one >amino acid. Instead of eight bits to a byte, there are three. After all, one >base pair by itself doesn't do much good. But, if a base pair is a bit, then In the same way, a byte doesn't do much good in floating point arithmetic.:-) The problem, of course, is that not all the genome is used for the message in polypeptide chains. There are noncoding regions (particularly in eukaryotic organisms); rRNAs (often many thousand copies of each gene); tRNAs (again with lots of copies except in the prokaryotes and organelles); etc. In humans, it is estimated that only 1-2% of all the DNA actually encodes for amino acids. This is mostly a problem of semantics. If we wish to use "byte" as the smallest unit of meaningful information, then the nucleotide is the byte. The addition of the complementary base (to make a base pair) adds no additional information, so the base pair could be considered as the "byte" as well. -- Ted H. Emigh Genetics and Statistics, North Carolina State U, Raleigh NC USENET: emigh@ecsvax.uucp DOMAIN: emigh%ecsvax.ncecs.edu ARPA: ecsvax!emigh@mcnc.org BITNET: NEMIGH@TUCC Distribution to monotremes and flightless waterfowl **RESTRICTED**
6065833@pucc.UUCP (03/31/87)
In article <2840@ecsvax.UUCP>, emigh@ecsvax.UUCP (Ted Emigh) writes, with regard to the information stored in genes: >If we wish to use "byte" as the >smallest unit of meaningful information, then the nucleotide is the byte. If you wish to regard the RNA's as the media for genetic storage, instead of DNA, fine. This is an alternative theory ('DNA is just RNA's backup'). But co nsider that even if you discount duplicate pieces of RNA, there is the problem of huge pieces of RNA junk stuck on the ends which are cut off as the RNA strings leave the nucleus. Not to mention that nonsense sequences in DNA are transcribed into RNA, and only later cut out. How do you tell which nucleotides are meaningful?
lew@ihlpa.UUCP (03/31/87)
In article <3310@udenva.UUCP>, agranok@udenva.UUCP (Alexander Granok) writes: > The whole arguement gets caught up in definitions, here. I would consider a > bit to be a base pair, and a byte to be the set of three that encodes for one > amino acid. Instead of eight bits to a byte, there are three. After all, one > base pair by itself doesn't do much good. But, if a base pair is a bit, then > what is a nucleotide? I guess it all depends on what you mean by "informa- > tion." Indeed! But this question has been well considered and has a conventional answer. A channel consisting of a series of uncorrelated symbols carries x bits per symbol where: x = sum ( i = 1 ; i<N ; i++ ) { P(i) * log2 ( 1 / P(i) ) } N is the number of symbol values. P(i) is the probability of occurrence of the ith symbol value. Note that the information carried depends on the usage. If we assume each value occurs with probability 1/N then the expression simplifies to: x = log2 N With this simplification, DNA has a capacity of 2 bits per base pair since there are 4 different base pairs. However, each triplet only codes for 20 amino acids plus a stop and start symbol so each triplet carries log2 ( 22 ) = 4.5 bits or 1.5 bits per base pair. If one goes on to consider the correlations among sequential codons the bits per base pair are further reduced. Lila Gatlin ( I think that's the name ) wrote a book in which she (?) tries to build up a big theory of genetic information content. I tried to read it some time ago and decided she didn't understand information theory. She kept talking about the information content of a single genome, which is meaningless. The above definition defines the information carrying capacity of a channel in terms of the statistics of the messages it carries. The information content of a given message is not defined. Lew Mammel, Jr.
roy@phri.UUCP (03/31/87)
In article <2112@PUCC.PRINCETON.EDU> 6065833@PUCC.PRINCETON.EDU writes: > But consider that even if you discount duplicate pieces of RNA, there is > the problem of huge pieces of RNA junk stuck on the ends which are cut > off as the RNA strings leave the nucleus. Not to mention that nonsense > sequences in DNA are transcribed into RNA, and only later cut out. How > do you tell which nucleotides are meaningful? Sounds like the old disk drive capacity game. How big is an Eagle? Unformatted, it's about 450 Mbytes. But, once you format, it it's down to about 380 (on a Sun anyway) and if you put a file system on it you're down to maybe 370 after you leave room for inodes and such, and if you consider that you have to leave 10% free space, maybe you're down to 335, not to mention the space you've set aside for swap space and maybe a spare root partition, and, well, the list goes on. The point is, it's all how you look at it. -- Roy Smith, {allegra,cmcl2,philabs}!phri!roy System Administrator, Public Health Research Institute 455 First Avenue, New York, NY 10016 "you can't spell deoxyribonucleic without unix!"
howard@cpocd2.UUCP (03/31/87)
In article <978@aecom.UUCP> werner@aecom.UUCP (Craig Werner) writes: > Hence, if a byte is a base pair, that's your answer, although >only two bits are required to specify a base, ergo a 'byte' could >actually be a tetranucleotide, but most sequences are stored as >letters (ATCG). In article <3310@udenva.UUCP> agranok@udenva.UUCP (Alexander Granok) writes: >The whole arguement gets caught up in definitions, here. I would consider a >bit to be a base pair, and a byte to be the set of three that encodes for one >amino acid. Instead of eight bits to a byte, there are three. After all, one >base pair by itself doesn't do much good. But, if a base pair is a bit, then >what is a nucleotide? I guess it all depends on what you mean by "informa- >tion." Most of us use the standard definition, in which a "bit" is enough information to answer a yes/no question. The reason a base pair is 2 bits is that there are 4 possibilities, not 2. Craig correctly points out that this means that 4 base pairs could be stored in an (8 bit) byte. He also correctly points out that most nucleotide sequences, when stored in machine-readable form, use one byte per base pair. This makes it easier to search for subsequences, reverse sequences, and places where genes overlap (as they do in some viruses). But the information content is no more than 2 bits; the rest is redundancy, and a compression program could easily squeeze such a file down. It is possible to store protein sequences using one byte per amino acid, and in that case you would be partly right. Here again, though, the real information content is less than 5 bits per amino acid. >"How many amino acids (words in the language of proteins) are encoded for on >the human chromosomes?" Since three bases code for one amino acid, the simplistic answer is N/3 where N is the number of base pairs. In reality things are messier: (1) there are long stretches of DNA that seem to be doing nothing, (2) there are various initiation and termination sequences that don't actually code for proteins, (3) in some organisms a single stretch of DNA/RNA can code for more than one protein (but never more than three). >or "How many books could these words fill?" I seem to >remember Sagan doing something like this on Cosmos. My recollection is that it was something like "1500 volumes of Encyclopedia Britannica" for the human gene set, or a wall full of books. But you should be able to calculate that from the numbers Craig posted. Just count the number of pages in a book, count the number of letters on a typical page, and divide N by both. -- Copyright (c) 1987 Howard A. Landman. Transmission of this material constitutes permission from the intermediary to all recipients to freely retransmit the material within USENET. All other rights reserved.
emigh@ecsvax.UUCP (03/31/87)
In article <2112@PUCC.PRINCETON.EDU> 6065833@PUCC.PRINCETON.EDU writes: >In article <2840@ecsvax.UUCP>, emigh@ecsvax.UUCP (Ted Emigh) writes, with >regard to the information stored in genes: > >>If we wish to use "byte" as the >>smallest unit of meaningful information, then the nucleotide is the byte. > >If you wish to regard the RNA's as the media for genetic storage, instead of >DNA, fine. This is an alternative theory ('DNA is just RNA's backup'). But co >nsider that even if you discount duplicate pieces of RNA, there is the problem >of huge pieces of RNA junk stuck on the ends which are cut off as the RNA >strings leave the nucleus. Not to mention that nonsense sequences in DNA >are transcribed into RNA, and only later cut out. How do you tell which >nucleotides are meaningful? I do not consider RNA as the media for genetic storage (except in the case of RNA viruses). RNA has two roles (and possibly more): 1) As an intermediate step in going from DNA to polypeptide chains; and 2) as molecules with enzymatic activity (rRNAs, tRNA, regulatory RNAs, etc). I also do not feel that just because a segment of DNA will not make it into a protein that it is "junk" -- only that we may not understand its functions. Obviously, 5' flanking regions have regulatory effects. 3' flanking regions are involved in termination of transcription. I am unsure of the role of introns, but feel that they are not their by chance. They may serve as protection against endonucleases; or they may be involved with nucleosome structure; or .... But even with all of this (rRNAs, introns, flanking regions, ...), some 60% of the DNA in the human genome has **UNKNOWN** function (which doesn't mean that it has no function). Rather than trying to say that each nucleotide MUST have some information, we should say that it is at the nucleotide level that we have the potential for information. As an analogy, my old North Star Horizon CP/M computer effectively has 56K memory. I am positive that there are bytes among those 56K that have NEVER contained ANY meaningful information -- but all 56K had the potential for containing meaningful information. -- Ted H. Emigh Genetics and Statistics, North Carolina State U, Raleigh NC USENET: emigh@ecsvax.uucp DOMAIN: emigh%ecsvax.ncecs.edu ARPA: ecsvax!emigh@mcnc.org BITNET: NEMIGH@TUCC Distribution to monotremes and flightless waterfowl **RESTRICTED**
werner@aecom.UUCP (04/03/87)
In article <3310@udenva.UUCP>, agranok@udenva.UUCP (Alexander Granok) writes: > > > base pair by itself doesn't do much good. But, if a base pair is a bit, then > what is a nucleotide? I guess it all depends on what you mean by "informa- > tion." For DNA, base pair and nucleotide are interchangable terms, so I had to laugh at the above. Each base is a nucleotide, and since DNA is complementary, each base automatically specifies the one across from it. The same cannot be said for RNA, which is single-stranded. For instance the partial sequence of of the recombinant plasmid, pBmCW5, reads: 5'ATAGCTGATGCAAGATGAAGCTCTTGG3' From that I can read the complementary strand effortlessly 5'CCAAGAGCTTCATCTTGCATCAGCTAT3' so that the whole thing becomes: 5'ATAGCTGATGCAAGATGAAGCTCTTGG3' 3'TATCGACTACGTTCTACTTCGAGAACC5' (and yes, the CW in pBmCW5 stands for Craig Werner) -- Craig Werner (MD/PhD '91) !philabs!aecom!werner (1935-14E Eastchester Rd., Bronx NY 10461, 212-931-2517) "I just won't sleep, that's all."