eesnyder@boulder.Colorado.EDU (Eric E. Snyder) (08/15/89)
I am currently trying to express a mutant _E. coli._ galactose receptor in a derivative of pUC19 in tryptophan auxotroph media for 19F-trp labeling for NMR. Unfortunately, our new mutants (all trp -> tyr) are not being expressed in our usual M9 + casamino acids media. All our other mutants grow well in LB and express GGR as well as the wild-type plasmid. Any ideas??? ------------------------------------------------------------------------- AAGGTGCAATGATGAGGAATTTTATCGTAGTTATGAATAATCCTGCAAGAGGTGCAAAACCCAGAGTACCTCA Eric E. Snyder Department of Molecular, I thought it was rain for a minute; Cellular and Developmental Biology I thought the game had been called. University of Colorado, Boulder TTCCACGTTACTACTCCTTAAAATAGCATCAATACTTATTAGGACGTTCTCCACGTTTTGGGTCTCATGGAGT -------------------------------------------------------------------------