arf@chinet.chi.il.us (Jack Schmidling) (08/29/89)
pol/e7 Article 2417 (1 more) in sci.bio: From: binkley@boulder.Colorado.EDU (Jon Binkley) Subject: Re: What's the Why and How of Mosquito Bites? > I don't see where Russell changed the subject. He states >very clearly that the only diseases which mosquitoes can >transmit are ones which also infect the mosquito. > >ARF says: > >I doubt that he said that. If he did, he is wrong. Did you >ever see mosquito die of malaria? >I'm amazed by this guy. How could someone so bloody ignorant be so arrogant? ARF says: Why don't you try answering the question instead of an inane personal attack? (Russell Turpin) says: >Who, pray tell, is manufacturing data? The major fabrication I see is the specious implication that something is scientific evidence only if it is garnered by controlled experiment, and that observation and statistical analysis do not count. >Since Galen....... ARF says: Excellent and persuasive stuff. Thank you for your input. >Perhaps it is because ARF is confused about the nature of scientific work that he is so suspicious of the way scientists are studying AIDS. My problem with the scientists is that most of the ones working on AIDS work for Big Brother and I have monumental suspicions of any information coming out of the government. Another problem I have with the scientists on this issue is the political nature of it. There is a politically active group in this country that has succeded in the fight for civil rights of the AIDS virus. No other deadly disease has ever been coddled and dealt with in the way that AIDS has. Obviously, if the scientist happens to belong to that politically active group, his results are suspect. ......................... I would like to thank everyone who participated in this discussion for their inputs. I think the politics probably prevent it from going much farther until or unless the big experiment is performed or simulated. I certainly learned a lot but will still avoid botanizing in the forest preserves on weekends. The Amateur Radio Forum (arf)
eesnyder@boulder.Colorado.EDU (Eric E. Snyder) (08/29/89)
In article <9397@chinet.chi.il.us> arf@chinet.chi.il.us (Jack Schmidling) writes: >My problem with the scientists is that most of the ones working on AIDS work >for Big Brother and I have monumental suspicions of any information coming >out of the government. > What sort of bullshit is this? Just about every scientist in America works for "Big Brother" in one form or another, whether it's NIH, NSF, or what ever funding agency you care to name..... some people..... --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGATTCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder I love this mansion, Department of Biochemistry 'though it's too many windows University of Colorado, Boulder to open half-way each morning Boulder, Colorado 80309 to close half-way each night. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
turpin@cs.utexas.edu (Russell Turpin) (08/29/89)
In article <11100@boulder.Colorado.EDU>, eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes: > .. Just about every scientist in America works > for "Big Brother" in one form or another, whether it's NIH, NSF, or what > ever funding agency you care to name..... Except for the geophysicists who work for Mobil, the molecular biologists who work Genentech, the chemists who work for Dupont, the mathematicians who work for EMI, the solid state physicists who work for IBM, etc. Yes, many scientists work for "Big Brother", perhaps most if you count any degree of federal funding as doing so, but "just about every" overstates things just a bit much. Russell
jim@csl-sun3.dcrt.nih.gov (jim sullivan) (08/29/89)
In article <9397@chinet.chi.il.us>, arf@chinet.chi.il.us (Jack Schmidling) writes: > pol/e7 > From: binkley@boulder.Colorado.EDU (Jon Binkley) > Subject: Re: What's the Why and How of Mosquito Bites? > > > I don't see where Russell changed the subject. He states > >very clearly that the only diseases which mosquitoes can > >transmit are ones which also infect the mosquito. > > > >ARF says: > > > >I doubt that he said that. If he did, he is wrong. Did you > >ever see mosquito die of malaria? > > >I'm amazed by this guy. How could someone so bloody ignorant be > >so arrogant? > > ARF says: > > Why don't you try answering the question instead of an inane personal attack? Well, jumping in the middle of this would seem dangerous after reading this discussion so far but I can't let this go by... How many infections has ARF had that killed him. Malaria *does* infect the mosquito. I think (am not sure) that it kills it as well. It does at least become infected when it bites a person infected with malaria. The life cycle of the disease has been very well documented for many years. I'd outline it here but I do not have my references handy. Has ARF even tried to pick up a reference book on this? > (Russell Turpin) says: > > >Who, pray tell, is manufacturing data? The major fabrication I > >see is the specious implication that something is scientific > >evidence only if it is garnered by controlled experiment, and > >that observation and statistical analysis do not count. > > > >Since Galen....... > > ARF says: > > Excellent and persuasive stuff. Thank you for your input. I don't know what else Mr. Turpin said in the article but his statement above is correct in that data is gathered in many forms. Science has determined over the many years what is acceptable and convincing and what is not. Statistics is a very good example of science defining what data will be considered as evidence of a phenomenon and what will not. Most evidence of the AIDS virus at first was gathered as statistical data derived from hospital records since, when it became first known to be a disease, there was no known cause of AIDS. But, through statistics, it was known how it was transmitted and that it *could* be transmitted *and* there was NO evidence of transmission through casual contact and that has been supported as more data has become available. AIDS has been around now, at least known to be here in the USA, for 10 years. The number of unexplained infections are *very* small. > > >Perhaps it is because ARF is confused about the nature of > scientific work that he is so suspicious of the way scientists > are studying AIDS. > > My problem with the scientists is that most of the ones working on AIDS work > for Big Brother and I have monumental suspicions of any information coming > out of the government. I have no problem with being suspicious of the government, that is part of the America culture. But, there are thousands of researchers working on the AIDS virus. The virus is being grown and is one of the most studied viruses in history. To continue this work on such a large scale, and in many countries, *and* to put a clamp on the results is at best a stretch of a paranoid imagination. It reminds me of those who propose the government is keeping a clamp on a cancer cure. It feeds those whose paranoia needs feeding. Jezzzz, the govt can't even keep things like the stealth bomber secret. Get real and calm down. > > Another problem I have with the scientists on this issue is the political > nature of it. There is a politically active group in this country that has > succeded in the fight for civil rights of the AIDS virus. No other deadly > disease has ever been coddled and dealt with in the way that AIDS has. > Obviously, if the scientist happens to belong to that politically active > group, his results are suspect. What is being fought is the paranoia and disinformation campaign waged by those who, I believe, really feel that a conspiracy is going on, even though there is no evidence to support it. Do you really think the lab technicians who are paid meager wages and do most of the lab work could keep their mouths shut about a conspiracy? Look at the notariety that Dr. Gallo at NIH received when he (ok, and the french :^) isolated the virus. Do you think he did it alone in a lab. He has many technicians as well as post-docs who would love to be propelled into bigger and better things by making a new discovery. If you have concluded that a deception exists, show some evidence of it and how the deception is being kept *so* secret. > > ......................... > > I would like to thank everyone who participated in this discussion for their > inputs. I think the politics probably prevent it from going much farther > until or unless the big experiment is performed or simulated. I certainly > learned a lot but will still avoid botanizing in the forest preserves on > weekends. > > The Amateur Radio Forum (arf) I am a little troubled by a signiture which seems to be a group of people called the amiture radio forum but speeks in the first person throughout this discussion. Is this really the statements of a group of people or of one person. I'd really like to know. I mean, talk about deceptions and conspiracies! Jim Sullivan jim@alw.nih.gov
turpin@cs.utexas.edu (Russell Turpin) (08/30/89)
In article <1177@nih-csl.UUCP>, jim@csl-sun3.dcrt.nih.gov (jim sullivan) writes: > ... Malaria > *does* infect the mosquito. I think (am not sure) that it > kills it as well. It does at least become infected when it > bites a person infected with malaria. The life cycle of > the disease has been very well documented for many years. ... While a mosquito, in order to become a vector for malaria, must first be infected by the plasmodium, this does not seem to affect the mosquito much. This should not be too surprising -- there are many infections that do not bother humans much either. That the mosquito is better adapted to the malarial plasmodium than we are is also not surprising. (1) It has a much shorter lifespan. (2) We are a non-essential part of the plasmodium's life-cycle. It does just fine going back and forth between mosquitos and various apes, who do not suffer as much as people do. Species that are either new or incidental to a disease organism's life-cycle often suffer more from the disease than the species which are essential to its life-cycle and with whom it has adapted. Russell