jackson@ttidca.TTI.COM (Dick Jackson) (09/01/89)
My girlfriend and I had this big argument -- I am hoping that at least one good person in this group will help settle it. Its about the variability in offspring from the same parents. I claimed that eggs and sperm from the same people contain identical genetic material and that variations in offspring occur because of semi-random combination when fertilization occurs. She maintains that sperm and eggs are all different at the gene level. The argument made us realise how ignorant we were about exactly what happens when chromasomes (sp?) come together and how the strands of DNA get combined -- is this known in detail? She is a nurse and should know this stuff; as an engineer I feel my ignorance is totally excusable. Dick Jackson
eesnyder@boulder.Colorado.EDU (Eric E. Snyder) (09/02/89)
In article <5760@ttidca.TTI.COM> jackson@ttidca.tti.com (Dick Jackson) writes: >My girlfriend and I had this big argument -- I am hoping that at least one >good person in this group will help settle it. > >Its about the variability in offspring from the same parents. I claimed >that eggs and sperm from the same people contain identical genetic >material and that variations in offspring occur because of semi-random >combination when fertilization occurs. She maintains that sperm and eggs >are all different at the gene level. "Crossing over" occurs during the pachytene and diplotene stages of meiotic prophase and thus genetic variation is present in both egg and sperm. When egg and sperm pool their genes to for the zygote, no further recombination occurs.... if recombination could occur at each mitotic division, we would be pretty scary looking....! --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGATTCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder I love this mansion, Department of Biochemistry 'though it's too many windows University of Colorado, Boulder to open half-way each morning Boulder, Colorado 80309 to close half-way each night. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
dmark@joey.cs.buffalo.edu (David Mark) (09/03/89)
In article <5760@ttidca.TTI.COM> jackson@ttidca.tti.com (Dick Jackson) writes: >My girlfriend and I had this big argument -- I am hoping that at least one >good person in this group will help settle it. > >Its about the variability in offspring from the same parents. I claimed >that eggs and sperm from the same people contain identical genetic >material and that variations in offspring occur because of semi-random >combination when fertilization occurs. She maintains that sperm and eggs >are all different at the gene level. > For diploid species like us and many other higher animals, each sperm cell contains exactly half of the genes of the ordinary cells of the male; however, it is a "more-or-less" random selection, one allele of each pair of genes. If there were 100 genes, there would be some 2^100 different sperm cells. And, there are way more than 100 genes!! The same goes for the eggs for diploid species. Think about it. If every spern cell from some male were identical, and every egg from each female, then every monogamous couple that had more than one child would have identical (except for age) children-- families with male and female children would be evidence of non-monogamy! Honeybees and other bees, wasps, and ants are an interesting exception. All males are haploid ("playing with a half set" of chromosomes) and so each sperm from a particular male bee, wasp, or ant is identical. But females are diploid like us, and eggs are genetically different, with a 0.5 probability of sharing any given gene. Unfertilized eggs develop into males. Thus male bees, wasps and ants have neither fathers nor sons! Brothers have a 50% chance of sharing any specified gene, just as do full brothers in diploid species. But the queen bee mates once, and stores the sperm from one male in her body, so sisters are 75% similar genetically, since the male half is identical and the female half is 50% similar. This is suggested as the "reason" than so may hymenopterids have evolved colonial social structures with female workers-- a female bee is more closely related to younger sisters than she would be to her own offspring. Thus, she maximizes the probability that her genes will be represented in the next "generation" by staying and helping mom raise more female offspring than by having offspring of her own. Stephen Jay Gould has an essay about this in one of his books. David Mark dmark@cs.buffalo.edu
eesnyder@boulder.Colorado.EDU (Eric E. Snyder) (09/03/89)
In article <9613@eerie.acsu.Buffalo.EDU> dmark@joey.UUCP (David Mark) writes: > >For diploid species like us and many other higher animals, each sperm cell >contains exactly half of the genes of the ordinary cells of the male; >however, it is a "more-or-less" random selection, one allele of each pair >of genes. If there were 100 genes, there would be some 2^100 different >sperm cells. And, there are way more than 100 genes!! The same goes for >the eggs for diploid species. > This is misleading.... Genes are not partitioned randomly; chromosomes are. Thus, assuming no recombination, there would be 2^23 different permutations of chromosome distribution in humans (haploid genome = 23 chromosomes). That is a large number (about 8 million) but not as large as 2^(the number of genes) Unfortunately, meiotic crossing-over complicates the picture considerably..... Thanks to ted@NMSU.Edu for correcting my math the first time 'round. --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGATTCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder I love this mansion, Department of Biochemistry 'though it's too many windows University of Colorado, Boulder to open half-way each morning Boulder, Colorado 80309 to close half-way each night. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------