rising@utzoo.uucp (Jim Rising) (08/23/89)
I discussed this argument with a colleague of mine who is an entomologist. He tells me that many mosquitos bite persons frequently--and hence can (as we know) pass malaria, yellow fever, etc. Thus, if the AIDS virus could proliferate in a mosquito it could be transmitted from person to person in the insect's saliva. He also said that there was no reason that the virus couldn't be transmitted mechanically by the mosquito's mouthparts (i.e. without proliferating in the insect). Apparently, several insect borne diseases are transmitted in this way (e.g. Chagas disease). I have not been reading all of these posting carefully, so all of this might have already been said. If so, I apologize for the duplication. Note also, please, that I am not saying that there is any evidence that mosquitos do transmit AIDS that I know of, only that it does not seem impossible. --Jim Rising -- Name: Jim Rising Mail: Dept. Zoology, Univ. Toronto, Toronto, Ontario, Canada M5S 1A1 UUCP: uunet!attcan!utzoo!rising BITNET: rising@utzoo.utoronto.bitnet
honig@BONNIE.ICS.UCI.EDU (David A Honig) (08/24/89)
When AIDS first started getting media hype, there was a report from french researchers that mosquitoes could be vectors. This was later surpressed/denied, and the public told "it can't happen". Sorry I don't have the reference. The facts are that the risks of transmission are proportional to the amount of blood transferred. This is a small, but nonzero, quantity when being bitten by a mosquito that's already fed.
werner@aecom.yu.edu (Craig Werner) (08/25/89)
In article <1989Aug23.144136.27580@utzoo.uucp>, rising@utzoo.uucp (Jim Rising) writes: > I discussed this argument with a colleague of mine who is an > entomologist. > insect's saliva. He also said that there was no reason that > the virus couldn't be transmitted mechanically by the mosquito's > mouthparts (i.e. without proliferating in the insect). Apparently, > several insect borne diseases are transmitted in this way (e.g. > Chagas disease). If I may correct this, Chagas disease is not spread to the person by the mouthparts of the bug in question. It is spread by so-called posterior station. After the bite, the insect, umm, defecates in the wound, depositing parasites that have been concentrated during passage in the insect digestive tract. It's not mechanical transmission. -- Craig Werner (future MD/PhD, 4.5 years down, 2.5 to go) werner@aecom.YU.EDU -- Albert Einstein College of Medicine (1935-14E Eastchester Rd., Bronx NY 10461, 212-931-2517) "Reading is sometimes an ingenius device for avoiding thought."
mmm@cup.portal.com (Mark Robert Thorson) (08/26/89)
> any evidence that mosquitos do transmit AIDS that I know of, only > that it does not seem impossible. > > --Jim Rising Of course the chance of infection is non-zero. But bear in mind that the chance is very low. Do you think you could start a forest fire with a single match? It is important to tell the public the chance is zero because any non-zero figure might cause an inappropriate reaction on the part of the public. For example, let's say mosquitoes (or if you read that article in Atlantic Monthly, it seems more likely that lice would be a vector, rather than mosquitoes) cause 1 AIDS case in the U.S. each year. Would you really advocate quarantine for the tens of thousands of AIDS patients because of that? Or the millions of HIV positive people? Please don't call it suppressing the evidence. Call it benign neglect. The sort of benign neglect we need more of, not less. We need it for the infinitesimal risk from Alar, nuclear power plants, etc. Let's save our scare stories for the real stuff, like tobacco and drunk driving.
honig@ics.uci.edu (David A. Honig) (08/27/89)
In article <21596@cup.portal.com> mmm@cup.portal.com (Mark Robert Thorson) writes: >Of course the chance of infection is non-zero. But bear in mind that the >chance is very low. Do you think you could start a forest fire with >a single match? It is important to tell the public the chance is zero >because any non-zero figure might cause an inappropriate reaction on the >part of the public. I can't believe you can overtly support hiding truth from the public. >For example, let's say mosquitoes (or if you read that article in Atlantic >Monthly, it seems more likely that lice would be a vector, rather than >mosquitoes) cause 1 AIDS case in the U.S. each year. Would you really >advocate quarantine for the tens of thousands of AIDS patients because of >that? Or the millions of HIV positive people? Regardless of my opinions on quarantine, I would like to know the facts. If someone hides the facts, why should I believe/trust them? If the facts are so insignificant, put lots of effort into emphesizing just how insignifcant, but don't lie. >Please don't call it suppressing the evidence. Call it benign neglect. >The sort of benign neglect we need more of, not less. We need it for the >infinitesimal risk from Alar, nuclear power plants, etc. Let's save >our scare stories for the real stuff, like tobacco and drunk driving. Well, what should we call it? That's what it is. Benign neglect? Yeah right. Let others decide for you. Great. Let the public know how low the risk is from nukes, pesticides, etc, and let them know the risks of the alternatives (eg, carcinogens and acid rain from coal, etc.) Don't surpress the evidence for any reason if you want the public to believe you. -- David A Honig
arf@chinet.chi.il.us (Jack Schmidling) (09/02/89)
dis/e8 Article 2441 (1 more) in sci.bio: From: mmm@cup.portal.com (Mark Robert Thorson) Subject: Re: Mosquitos & AIDS Thorson says: >Of course the chance of infection is non-zero. But bear in mind that the chance is very low. Do you think you could start a forest fire with a single match? It is important to tell the public the chance is zero because any non-zero figure might cause an inappropriate reaction on the part of the public. >Would you reallyadvocate quarantine for the tens of thousands of AIDS patients because of that? Or the millions of HIV positive people? >Please don't call it suppressing the evidence. Call it benign neglect. ARF says: Call it dis-information! Exactly my position when I started this subject. AIDS patients and HIV positives should be quarantined for reasons that have nothing to do with near-zero vectors such as mosquitoes. They should be quantined because they are spreading a deadly disease among healthy populations and Big Brother's dis-information is killing people. The majority of AIDS patients brought the disease upon themselves but dis-informatiom allows them to spread it to others who can not control the behavior of the carriers. The only valid reason for soft selling the mosquito transmission of AIDS is to protect the ENVIRONMENT from the massive destruction that would result from a hi-tech, rampaging war on mosquitoes. The Amateur Radio Forum (arf)
eesnyder@ncar.UCAR.EDU (Eric E. Snyder) (09/02/89)
In article <9463@chinet.chi.il.us> arf@chinet.chi.il.us (Jack Schmidling) writes: >AIDS patients and HIV positives should be quarantined for reasons that have >nothing to do with near-zero vectors such as mosquitoes. They should be >quantined because they are spreading a deadly disease among healthy >populations and Big Brother's dis-information is killing people. > Give me a break! Knowing what we now know about HIV transmission, it is quite possible to allow HIV+ individuals to live free in society. Simply following the Surgeon General recomendations is enough to greatly reduce the chance of hetero- or homosexual transmission or transmission as the result of IV drug use. A little good sense can reduce that probability to near zero. I don't think that can be considered government dis-information! >The majority of AIDS patients brought the disease upon themselves but >dis-informatiom allows them to spread it to others who can not control the >behavior of the carriers. Sorry to cross post this garbage to sci.med.aids, but this sort of attitude is so disgusing....perhaps someone would like to set this person straight. _Please_ reply to arf@chinet.chi.il.us.... a bunch of follow-ups could really clog the net.... --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGATTCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder I love this mansion, Department of Biochemistry 'though it's too many windows University of Colorado, Boulder to open half-way each morning Boulder, Colorado 80309 to close half-way each night. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
arf@att.att.com (09/04/89)
late/e8
Article 2452 in sci.bio:
From: boulder!boulder!eesnyder@ncar.UCAR.EDU (Eric E.
Snyder)
Newsgroups: sci.bio,sci.med.aids
Subject: Re: Mosquitos & AIDS
Snyder says:
>Give me a break! Knowing what we now know about HIV
transmission, it is quite possible to bla bla bla...
ARF says:
In keeping with my previous posting, I will translate yours:
Knowing what Big Brother has allowed us to know about
HIV.......bla bla bla............
You are a little late in this discussion. My adrenaline is
about used up.
In summary, it was agreed that Big Brother's dis-information
was necessary to protect the rights of HIV not to be
persecuted and to maintain a steady market for AZT.
The Amateur Radio Forum (arf) jim@csl-sun3.dcrt.nih.gov (jim sullivan) (09/06/89)
<1989Aug23.144136.27580@utzoo.uucp> <21596@cup.portal.com> <26867@shemp.CS.UCLA.EDU> Distribution: world In article <26871@shemp.CS.UCLA.EDU>, chinet!arf@att.att.com writes: > ARF says: > > In summary, it was agreed that Big Brother's dis-information > was necessary to protect the rights of HIV not to be > persecuted and to maintain a steady market for AZT. > > The Amateur Radio Forum (arf) Yea... that's it! Fool the country so that the big drug companies can come in with an expensive cure... no, no, no, a treatment... yea... Jezzzzz, where did the ARF, whatever that is, come up with such garbage. I remember the late 70s when AIDS was just breaking into the news. This kind of garbage was everywhere. And after 10 years, 10 YEARS, this stuff is still being spouted! To make such a claim you (ARF) had better have a lot of *good* evidence. So far, all the evidence is against your position. ARF has offered nothing convincing, none except the vague government conspiracy BS, which is not evidence, just an excuse to push the burden of proof off their own shoulders. If HIV was so contagious as you state, where are the people who caught the disease in a casual way (non-homosexual, non-IV-drug user, non- high-risk-group)? Why would the Reagan administration *want* to protect the rights of HIV infected people when they could have infected the rest of the population? In summary, the burden of proof is on ARF to backup his/their/whatever claims. By not doing this, their claims have no validity and should be ignored. Jim Sullivan jim@alw.nih.gov