werner@aecom.yu.edu (Craig Werner) (09/06/89)
While we're on the subject of conspiracy theories, here's a bit
of debunking. The cost of AZT is usually expressed as an annual cost:
$8000-10,000. That seems like a lot of money because it probably is
a lot of money.
However, a rough estimate of the cost of producing AZT places
the actual cost of production at about 20-35% the cost that it is actually
sold for. True, that's a 300% markup, but considering the cost of clinical
trials, that's actually not way out of line. AZT is a biochemical, and it
costs roughly $20/gram. That's about $2 pill.. Quite a commonly used
pharmaceutical drugs cost more than that, but are used for only short
periods of time. AZT is taken 4 times a day, for the rest of one's
life, or until it can no longer be tolerated. That's why it costs so much.
It's not the first prescription that gets you, it's all the refills.
--
Craig Werner (future MD/PhD, 4.5 years down, 2.5 to go)
werner@aecom.YU.EDU -- Albert Einstein College of Medicine
(1935-14E Eastchester Rd., Bronx NY 10461, 212-931-2517)
Everything's different. Nothing's changed. Well, only maybe slightly rearranged.drogers@riacs.edu (David Christopher Rogers) (09/15/89)
[Apologies if this is appearing twice. My mailer barfed trying to post to
sci.med.aids]
Message-ID: <2434@aecom.yu.edu>
From: werner@aecom.yu.edu (Craig Werner)
While we're on the subject of conspiracy theories, here's a bit
of debunking. The cost of AZT is usually expressed as an annual cost:
$8000-10,000. That seems like a lot of money because it probably is
a lot of money.
However, a rough estimate of the cost of producing AZT places
the actual cost of production at about 20-35% the cost that it is actually
sold for.
In other words, a cost of production somewhere between $1600 and $3500
for a years dose. And a profit somewhere between $5200 and $8000 a year
for each person taking it.
True, that's a 300% markup, but considering the cost of clinical
trials, that's actually not way out of line. AZT is a biochemical, and it
costs roughly $20/gram. That's about $2 pill..
Considering the drug was initially developed at public expense in government
labs, this seems pricey. (BTW, B-W claims a cost of about $1.50/pill).
The "cost of clinical trials" being used to justify the cost of AZT would
be funny if the clinical trials weren't in such a shambles.
ACT-UP has asked Burroughs-Wellcome to justify their cost by opening their
books, or lower the price. They have refused to do either.
I've even heard it said how much money B-W has LOST on AZT. Even THEY
haven't claimed any loss of money on this product.
Quite a commonly used pharmaceutical drugs cost more than that, but
are used for only short periods of time. AZT is taken 4 times a day,
for the rest of one's life, or until it can no longer be tolerated.
How many "commonly-used" drugs have a profit-margin of > $5000 per person/yr?
And a customer base that may be >1M in a few years??
The real issue is that Burroughs-Wellcome has only a 7-year monopoly on
AZT granted by the government, and they want to soak as much as they can
out of it before they lose the monopoly or government finished one of its
longwinded trials and authorizes some other drug.
That's why it costs so much. It's not the first prescription that
gets you, it's all the refills.
Damn right. The only debunking to do here is the myth of the drug company
acting in the interests of the patients, when it's actually soaking the
patients and the taxpayers on its government-granted monopoly.
David Christopher Rogers
drogers@riacs.eduwerner@aecom.yu.edu (Craig Werner) (09/16/89)
In article <1704@hydra.riacs.edu>, drogers@riacs.edu (David Christopher Rogers) writes: > The "cost of clinical trials" being used to justify the cost of AZT would > be funny if the clinical trials weren't in such a shambles. > > I've even heard it said how much money B-W has LOST on AZT. Even THEY > haven't claimed any loss of money on this product. > > Quite a commonly used pharmaceutical drugs cost more than that, but > are used for only short periods of time. AZT is taken 4 times a day, > for the rest of one's life, or until it can no longer be tolerated. > > How many "commonly-used" drugs have a profit-margin of > $5000 per person/yr? > And a customer base that may be >1M in a few years?? > > That's why it costs so much. It's not the first prescription that > gets you, it's all the refills. > > Damn right. The only debunking to do here is the myth of the drug company > acting in the interests of the patients, when it's actually soaking the > patients and the taxpayers on its government-granted monopoly. > > David Christopher Rogers Hey look, it's easy to shout "conspiracy," and it attracts a lot of attention. I never implied that any drug company acts solely in the interest of patients. Of course, the more patients that are helped, the more sales they have, and the better the bottom line. So they obviously care a little bit. The cost of clinical trials and the drug they gave away during the "compassionate use" phase prior to initial approval was worth, by some estimates $100 million dollars. Standard practice is to try to recover that money within three years. Since initially it was only approved for those with AIDS, a moving target of roughly 20-40,000 people implies you have to make several thousand dollars per person. Hey, life isn't fair sometimes. Of course, now that the number of patients that the drug has been approved for has increased, they should (and have already announced that they will) lower the price (but probably not as much as they should.) What if AZT were sold at cost. A rough guess at the chemistry says it should cost roughly $2/pill. Boroughs-Welcome quotes $1.50 a pill. They're better chemists than I give them credit for. 4 pills a day, 365 days/yr. That's still over $2000/yr. AZT is just plain expensive. On a yearly basis, consider Ibuprofen by comparison. I paid 3 bucks for 24 pills. That lasts me a month or so, because I just get migraines, but imagine I had arthritis and took 6 a day. That's turns into over $1000/yr, and Ibuprofen is almost a commodity. You can buy it in the supermarket. But expressed as a yearly figure, it ends up in the same neighborhood as the commonly quoted price for AZT. For another comparison, remember that on a gram for gram basis AZT costs roughly 20% of the price of Cocaine. -- Craig Werner (future MD/PhD, 4.5 years down, 2.5 to go) werner@aecom.YU.EDU -- Albert Einstein College of Medicine (1935-14E Eastchester Rd., Bronx NY 10461, 212-931-2517) "Disinformation is one thing, but misinformation is unforgiveable."
drogers@riacs.edu (David Christopher Rogers) (09/17/89)
Messge-ID: <2446@aecom.yu.edu>
From: werner@aecom.yu.edu (Craig Werner)
The cost of clinical trials and the drug they gave away during
the "compassionate use" phase prior to initial approval was worth, by
some estimates $100 million dollars.
It is crazy to count the value of the "drug they gave away" as part of
the `cost' of the trial, as the value is set by whatever inflated price
B-W gives it.
As for B-W spending $100M on these trials, I'd really like to see evidence.
Let's see how much money they spent, and how much they made. Let them
open their books, rather than let people defend them with completely
unsubstantiated estimates.
Standard practice is to try to recover that money within three years.
Since initially it was only approved for those with AIDS, a moving
target of roughly 20-40,000 people implies you have to make several
thousand dollars per person.
Pretty amazing underestimation of the numbers of people with HIV infection,
who may need their drug? To base the price on the most conservative
estimate of sales, you can then be "pleasantly surprised" when you
make lots of money when your estimate are too low.
Awful convenient.
Hey, life isn't fair sometimes.
I think we can agree there is a lot of unfairness somewhere in this mess.
Of course, now that the number of patients that the drug has been
approved for has increased, they should (and have already announced
that they will) lower the price...
Wrong. In a meeting with AIDS activists last week, B-W refused to commit
to lower the price. Instead, they said they are "studying" the issue.
... (but probably not as much as they should.)
I think we agree here.
What if AZT were sold at cost. A rough guess at the chemistry
says it should cost roughly $2/pill. Boroughs-Welcome quotes $1.50 a
pill. They're better chemists than I give them credit for. 4 pills a
day, 365 days/yr. That's still over $2000/yr. AZT is just plain
expensive.
On a yearly basis, consider Ibuprofen by comparison. I paid 3
bucks for 24 pills. That lasts me a month or so, because I just get
migraines, but imagine I had arthritis and took 6 a day. That's turns
into over $1000/yr, and Ibuprofen is almost a commodity. You can buy it
in the supermarket. But expressed as a yearly figure, it ends up in the
same neighborhood as the commonly quoted price for AZT.
Your argument seems to be that AZT isn't that much more expensive than
other drugs. Perhaps (though calling $1000/yr and $8000/yr "in the same
neighborhood" is stretching it); but this sidesteps the real issues, which
are: is the price fair (is B-W "price-gouging"), and: is the price so
high that people who need the treatment for their lives dying because they
can't afford it?
For another comparison, remember that on a gram for gram basis
AZT costs roughly 20% of the price of Cocaine.
To compare AZT, needed by people for their LIVES, with the yuppie pleasure
drug cocaine is a callous trivialization of an issue vital to HIV+ people.
AZT is not a "discretionary" purchase for "disposable" income. People
will DIE if they cannot afford it.
David Christopher Rogers
drogers@riacs.edudjh@illini.osc.edu (David Heisterberg) (09/18/89)
I'm not going to make any excuses for drug companies either, but in the vanishingly small part I have in all of this, I will have spent the equivalent of $1M to do a potential energy surface calculation for just one possible new anti-HIV drug. Research costs can be just astronomical. And you know the saying, "If we knew what we were doing it wouldn't be research." For every drug that makes it out, there can be hundreds to thousands that don't. Burroughs-Wellcome may be over-charging, they may not. I don't know all the facts - do you? David J. Heisterberg Ohio Supercomputer Center
dyer@spdcc.COM (Steve Dyer) (09/19/89)
In article <1711@hydra.riacs.edu> drogers@riacs.edu (David Christopher Rogers) writes: >Wrong. In a meeting with AIDS activists last week, B-W refused to commit >to lower the price. Instead, they said they are "studying" the issue. You probably know now that today B-W lowered the price of AZT from roughly $1.50/capsule to $1.20. -- Steve Dyer dyer@ursa-major.spdcc.com aka {ima,harvard,rayssd,linus,m2c}!spdcc!dyer dyer@arktouros.mit.edu, dyer@hstbme.mit.edu
pell@boulder.Colorado.EDU (Anthony Pelletier) (09/20/89)
In article <1711@hydra.riacs.edu> drogers@riacs.edu (David Christopher Rogers) writes: > >To compare AZT, needed by people for their LIVES, with the yuppie pleasure >drug cocaine is a callous trivialization of an issue vital to HIV+ people. >AZT is not a "discretionary" purchase for "disposable" income. People >will DIE if they cannot afford it. > >David Christopher Rogers (Cocaine? Yuppie pleasure drug??? Where have you been?) The sad truth is that they are going to DIE anyway (capitals emulating your own). Frankly, I am surprised none of the conspiracy-minded have concluded that the FDA and B-W are in cahouts because the FDA allows the sale of a drug that does very little, if anything to help these poor people--we always come down hard on the con-artists selling "miricle cures" to those dying of cancer. Now obviously, FDA was trying to placate the demonstrators insisting that AZT be cleared for use and was not doing B-W's bidding--but then, I am not conspiracy minded. But, I still wonder why others have not accused B-W of preying on people's fear of dying and selling them a virtually useless product to make a profit. -tony
rjw@PacBell.COM (Rod Williams) (09/20/89)
>You probably know now that today B-W lowered the price of AZT from >roughly $1.50/capsule to $1.20. In today's (9/19) New York Times, the article reporting this also includes : Robert Uhl, a pharmaceutical analyst with Salomon Brothers in New York said he believes the company [Burroughs-Wellcome] has already recovered its initial investment in the drug, which has been estimated at $80 million to $180 million. Estimates of the company's annual profit from the drug now range from $25 million to $100 million per year, depending on how they are calculated. Estimates of the cost of producing the $1.20 capsule, aside from research and development, range from 7 to 15 cents per capsule, by Dr. Mathilde Krim of the American Foundation for AIDS Research, to 33 to 53 cents, by industry analysts. The article also says that people with 'advanced cases of AIDS' need 12 capsules per day, while asymptomatic HIV+ people generally take 5 capsules per day. More than 20,000 people worldwide are currently taking AZT. That's expected to rise to 100,000 as a result of the recent studies showing its effectiveness in delaying the onset of the disease in asymptomatic HIV+ people, with perhaps 'several hundred thousand more' eligible to take it. -- Rod Williams * * * * * * * * * * * * * * * * * * * * * Bellcore * Don't hang about in the closet - * Piscataway, New Jersey * Wear yourself out! *
coren@speed (Robert Coren) (09/20/89)
From article <11815@boulder.Colorado.EDU>, by pell@boulder.Colorado.EDU (Anthony Pelletier): > Frankly, I am surprised none of the conspiracy-minded have concluded > that the FDA and B-W are in cahouts because the FDA allows the sale of a drug > that does very little, if anything to help these poor people--we always > come down hard on the con-artists selling "miricle cures" to those dying of > cancer. Now obviously, FDA was trying to placate the demonstrators insisting > that AZT be cleared for use and was not doing B-W's bidding--but then, I > am not conspiracy minded. > But, I still wonder why others have not accused B-W of preying on people's > fear of dying and selling them a virtually useless product to make a profit. > I was wondering about this, myself. The _New York Native_ has had a number of articles expressing the view that AZT is useless or worse, and that the original studies "proving" its effectiveness were flawed, and that isn't it curious that the data from the latest studies showing its efficacy to be even greater thatn supposed haven't been made available. Some of this stuff, particularly the articles by John Lauritsen, read pretty convincingly. It's all tied up with the _Native_'s insistence that HIV as the sole cause of AIDS is far from proven -- an idea that is finally beginning to make its way into other publications. On the other hand, it also gets tied up with a certain level of polemical conspiracy-theorizing that makes it sometimes hard to take any of it seriously. I have been sufficiently influenced by what I've read there to cringe inwardly whenever I read or hear of the provision of AZT to an ever-increasing segment of the population as a high (or even sometimes the only) priority in AIDS work. On the other hand, there was the survey in this newsgroup recently (which I'm too lazy to go look for) which quoted responses from several individuals who claimed to have been helped by AZT. Of course, anecdotal evidence is not considered conclusive one way or the other. But I was a little surprised at the complete lack (until Tony's post) of questioning the efficacy/safety/advisability of AZT. I think there's a tendency to forget what the "ID" in "AIDS" stands for. It isn't "the virus" (if there is indeed such a thing) that kills you; it's the things that get you because your immune system isn't functioning. Does AZT do anything directly for the immune system? Robert
eesnyder@ncar.UCAR.EDU (Eric E. Snyder) (09/20/89)
In article <929@paperboy.OSF.ORG> coren@osf.org writes: > >I think there's a tendency to forget what the "ID" in "AIDS" stands >for. It isn't "the virus" (if there is indeed such a thing) that kills >you; it's the things that get you because your immune system isn't >functioning. Does AZT do anything directly for the immune system? Think about it. The reason "your" immune system is not functioning is because there are all these little HIVs reproducing in your precious little CD4+ lymphocytes and killing a great many of them in the process. AZT stops viral reproduction by interfering with RNA-dependent DNA polymerase (AKA reverse transcrpitase) a la di-deoxy sequening. Although the HIV pro- virus can very well be lurking in stem cells, stop it replicating and T4 lymphs should start coming back.... unless you are really in a bad way. --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder I love this mansion, Department of Biochemistry 'though it's too many windows University of Colorado, Boulder to open half-way each morning Boulder, Colorado 80309 to close half-way each night. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
dyer@spdcc.COM (Steve Dyer) (09/20/89)
Pelletier should know better than to make such an irresponsible statement
as he has, but he's just another controversialist who would prefer to drop
a bomb into the middle of a group of people who don't necessarily have the
background to give his comment (along with the _Native's_ ravings) the
isolation it deserves. He'd sing another tune about AZT's uselessness
were he HIV+ and exhibiting early symptoms of AIDS or ARC.
--
Steve Dyer
dyer@ursa-major.spdcc.com aka {ima,harvard,rayssd,linus,m2c}!spdcc!dyer
dyer@arktouros.mit.edu, dyer@hstbme.mit.edupell@boulder.Colorado.EDU (Anthony Pelletier) (09/21/89)
In article <4620@ursa-major.SPDCC.COM> dyer@ursa-major.spdcc.COM (Steve Dyer) writes: >Pelletier should know better than to make such an irresponsible statement >as he has, but he's just another controversialist who would prefer to drop >a bomb into the middle of a group of people who don't necessarily have the >background to give his comment (along with the _Native's_ ravings) the >isolation it deserves. He'd sing another tune about AZT's uselessness >were he HIV+ and exhibiting early symptoms of AIDS or ARC. > Sorry to offend you steve. Remember i did not say I subscribed to conspiracy theories and there are alot of polemics, as was pointed out. I merely wondered why more was not made of it. I guess I could be said to be dropping a bomb. But I think you are underestimating the audience here if you think they could not tell that I was not propogating the controversy, just asking about it. I also did not bring in the "Native's" ravings. Someone else did. I think, at best, the efficacy of AZT is debatable. It may prolong life, it may not. The controlled studies to test it are not going to be done (who wants to be in the control group?). Its in vitro effect on the the replication of the virus certainly is not in doubt (nor is even this effect 100%) and the biological basis of the effect is well understood. What is in doubt is how effective preventing RT-mediated replication will be in preventing the devastating effects of the disease. You should know this. Its means of spreading once established is not understood, nor is its means of killing more cells than it appears to infect (perhaps fusing them, but it is not clear). It need not use RT to do this. As for me singing a different tune if I had the disease: It is interesting that a couple of people have pointed that out. Personally, I would not wish that on anyone in anger like that. I might want to try AZT or some other experimental drug. I am, by profession, an experimentalist. I might try it out of professional curiosity. I don't know how I would react. And if I don't know, certainly you don't. --------------------------------------- Whether the virus is the causative agent of the disease or not is debated by some, but I think the evidence for its role is pretty conclusive. The arguments I have read for the other side seem poorly founded. But, I would be open to hearing some of the ones people think are good. I don't think the one issue has to be related to the other--whether or not HIV is the cause, the efficacy of AZT can be debated. All I meant was that, sociologically, I find it interesting. We have learned to live with cancer, as a culture. If someone has in-operable cancer and several doctors tell him he will die, we feel sorry about it, but accept it. We accept that medical science is doing its best. If he goes to spend his money and little remaining time in Mexico at a clinic that says they can help, we see the doctors there as quacks and con-men taking money from a dying man. AIDS is different. Many people see medical science and the pharmacutical industry as an advisary--or at best, an untrustworthy ally with whom one deals out of desperation. When science says "there is nothing more we can do" they are accused of holding back. People offering the latest "cure" are saviors rather than quacks. I'm not sure I know why this is true. I was curious about it. Sorry if I offended some. -tony
dyer@spdcc.COM (Steve Dyer) (09/21/89)
In article <11864@boulder.Colorado.EDU> pell@boulder.Colorado.EDU (Anthony Pelletier) writes: >I think, at best, the efficacy of AZT is debatable. It may >prolong life, it may not. The controlled studies to test it are not >going to be done (who wants to be in the control group?) The original studies of AZT's efficacy in patients with advanced AIDS used control groups, as did the more recent studies which looked at the effect of AZT on delaying the onset of ARC and AIDS in HIV+ asymptomatic subjects. The studies were terminated early because the trends were unmistakably clear. I don't understand what feeds your pessimism, which is certainly not in the medical mainstream of opinion. >What is in doubt is how effective preventing RT-mediated replication will >be in preventing the devastating effects of the disease. You should >know this. Its means of spreading once established is not understood, >nor is its means of killing more cells than it appears to infect (perhaps >fusing them, but it is not clear). It need not use RT to do this. No one could make a claim that anti-RT-therapy with AZT is the end-all of AIDS therapy. To use your cancer analogy, AZT right now is just a palliative. That it appears to prolong life is pretty much unarguable. It does not cure or arrest the disease. Still, if a drug can add several years of useful life to someone with an otherwise incurable illness, it is usually thought to be a good thing. If we threw out all drugs used in cancer chemotherapy which did not cure the disease but only served to keep a person more comfortable, or alive for a few more months or years, we'd have very little to work with (patients OR drugs.) >As for me singing a different tune if I had the disease: It is interesting >that a couple of people have pointed that out. Personally, I would not wish >that on anyone in anger like that. I would hope that my comment would not be taken as wishing AIDS on anyone. -- Steve Dyer dyer@ursa-major.spdcc.com aka {ima,harvard,rayssd,linus,m2c}!spdcc!dyer dyer@arktouros.mit.edu, dyer@hstbme.mit.edu
tidswell@endor.harvard.edu (Ian Tidswell) (09/21/89)
From 0 to 2 postings in 1/2 hour. Whatever next? I was meaning to post this a couple of days ago when the issue was really hot, but it took me until now to give up trying to send stuff from the system I use most of the time, and resort to the machine where the administrators know what they are doing. Still, it seems like the discussion might benifit from the information. Heres some info I remember about Burroughs-Wellcome from reading an article in The Guardian (a national daily in the UK) a week or so ago. My already failing mind may have some of the details wrong. 75% of B-W stock is owned by the B-W Foundation, a UK based NON-PROFIT organization dedicated to medical research and education. The remaining 25% of stock is traded on the London Stock Exchange. The article I read was in the business section, and seemed to suggest good times ahead for B-W and its stockholders (not too surprising) and the B-W might sell up to another 15% of stock to cash in on its high share price and improve the financial security of the Foundation. They did not spend any time saying what exactly the Foundation does. This seems to change the equation of the discussion somewhat. What the B-W Foundation is doing with the money raised from AZT sales, I don't know, but if it ALL goes toward AIDS research and education, then maybe they are not the slimes that has been suggested here. Anyway, they just reduced the price 20%. --- Ian Tidswell (ian@xray.harvard.edu)
mmm@cup.portal.com (Mark Robert Thorson) (09/23/89)
Could someone present an overview of the production process for AZT? I seem to recall seeing a description somewhere. I believe it starts with some strange raw material, codfish semen or something, and has many steps. Is it something that could be done on a bootleg basis?
werner@aecom.yu.edu (Craig Werner) (09/24/89)
> Could someone present an overview of the production process for AZT? > I seem to recall seeing a description somewhere. I believe it starts > with some strange raw material, codfish semen or something, and has many > steps. Is it something that could be done on a bootleg basis? The starting material for AZT is DNA. The cheapest way to get DNA in large quantities of DNA is fish sperm, usually salmon or herring. You hydrolyze the DNA, separating the 4 nucleotide-5'-monophosphates that result, then you collect the Thymidine-5'-monophosphate (TMP), substitute the 3'OH for a 3' N3 (azido) group, and dephosphorylate it. From a rough calculation, in this very group, several years ago I computed that the cost to make it on a small scale, comes very close to the price that they are selling it for (i.e., it would be very hard to make it on a small scale for much less than $10/gram, and it would probably cost closer to $20. Bouroughs-Welcome now sells it for $12/gram. My comment is that they are much better organic chemists than I initially gave them credit for. However, what really makes AZT seem so expensive is the fact that the yearly dosage approaches 3000 pills. 3000 times any per dose cost is going to add up to a lot of money. -- Craig Werner (future MD/PhD, 4.5 years down, 2.5 to go) werner@aecom.YU.EDU -- Albert Einstein College of Medicine (1935-14E Eastchester Rd., Bronx NY 10461, 212-931-2517) "Comedy, like Medicine, was never meant to be practiced by the general public."
rmadison@euler.Berkeley.EDU (Linc Madison) (09/24/89)
In article <22423@cup.portal.com> mmm@cup.portal.com (Mark Robert Thorson) writes: >Could someone present an overview of the production process for AZT? >I seem to recall seeing a description somewhere. I believe it starts >with some strange raw material, codfish semen or something, ... No, no, no. That's *CODPIECE* semen... ;-> -- Linc Madison rmadison@euler.berkeley.edu {uunet,sun}!euler!rmadison "Do not adjust your mind; it is reality that is malfunctioning."