cs225202@umbc5.umbc.edu (Sang J. Moon) (10/30/89)
Just a thought... I know that the basic building blocks of DNA can be now
created from inorganic molecules, but can biologists use these building blocks
to create viable DNA which will cbecome an actual organism?
-----------------------------------------------------------------------
"Those who yell the loudest, say the least."terry@utastro.UUCP (Terry Hancock) (10/31/89)
In article <2461@umbc3.UMBC.EDU> cs225202@umbc5.umbc.edu.UUCP (Sang J. Moon) writes: >Just a thought... I know that the basic building blocks of DNA can be now >created from inorganic molecules, but can biologists use these building blocks >to create viable DNA which will cbecome an actual organism? > No, as I understand it, there are some problems: 1. We don't yet have the ability to construct arbitrary sequences of DNA. We are limited to a) simple code sequences (such as all one type, or sets of three, or something) or b) copying codes that are found naturally. I would be VERY interested in info refuting this statement, if such exists. 2. Even if we COULD do 1., we don't know enough about molecular biology to make a plan for a viable organism (unless we copy extensively from an existing one). There is much study left to be done. Caveat -- I am NOT a biologist, I am an astronomer, I get these silly ideas from my fiancee, who doesn't get the net. I'll have to ask her about any technical questions. ********************************** Terry Hancock terry@astro.as.utexas.edu ********************************** >----------------------------------------------------------------------- > "Those who yell the loudest, say the least."
mkkuhner@codon2.berkeley.edu (Mary K. Kuhner;335 Mulford) (10/31/89)
In article <2461@umbc3.UMBC.EDU> cs225202@umbc5.umbc.edu.UUCP (Sang J. Moon) writes: >Just a thought... I know that the basic building blocks of DNA can be now >created from inorganic molecules, but can biologists use these building blocks >to create viable DNA which will cbecome an actual organism? It depends on whether you consider a virus alive. A small virus could probably be sythesized quite readily. Cells, however, have much more to them than DNA. My favorite experiment showing the complexity of non-DNA information in the cell was done with a protozoan which is covered with cilia, all lined up the same way. Very precise microsurgery was used to cut a strip off of the cell wall and put it back in reverse. Somehow the cell survives this, and ends up with a row of backwards cilia. All descendents of that cell have a similar row, because the old cell's cilia are used as templates for the new arrangement. We are a long way from being able to put together a cell from scratch. Mary Kuhner mkkuhner@enzyme.berkeley.edu
wrp@biochsn.acc.Virginia.EDU (William R. Pearson) (10/31/89)
In article <4516@utastro.UUCP> terry@astro.UUCP (Terry Hancock) writes: ]In article <2461@umbc3.UMBC.EDU> cs225202@umbc5.umbc.edu.UUCP (Sang J. Moon) writes: ]>Just a thought... I know that the basic building blocks of DNA can be now ]>created from inorganic molecules, but can biologists use these building blocks ]>to create viable DNA which will cbecome an actual organism? ]> ] No, as I understand it, there are some problems: ] ] 1. We don't yet have the ability to construct arbitrary ] sequences of DNA. We are limited to a) simple code ] sequences (such as all one type, or sets of three, or ] something) or b) copying codes that are found ] naturally. ] I would be VERY interested in info refuting ] this statement, if such exists. ] ] 2. Even if we COULD do 1., we don't know enough about ] molecular biology to make a plan for a viable organism ] (unless we copy extensively from an existing one). There ] is much study left to be done. ] It is technically possible to make any DNA sequence you like. However, most machines that do this are limited to 100 unit pieces, and living organisms have considerably more DNA. (The 100 unit pieces can be linked however.) To give you an idea of the scale involved, small viruses have 5000 - 50,000 units (nucleotides) of DNA, large viruses 200,000 - 500,000 nucleotides, E. Coli (our favorite bacteria) 4,000,000, fruit flies: 80,000,000 (I recall), mammals: 3,000,000,000. Thus, it would take a lot of pieces to do it. And it is certainly true that we do not know enough about the genes required to maintain an independent functioning organism to design the DNA molecule from scratch. The first complete sequence of an organism, E. Coli, may be known in the next 2 years. Once it is known, it would be technically possibly to synthesize an E. Coli DNA molecule from organic chemicals, but only by copying the E. Coli sequence. Even given the molecule, we do not know how to build an environment for it that would allow it to be replicated and start making the things E. Coli needs to grow.
turpin@cs.utexas.edu (Russell Turpin) (10/31/89)
In article <1989Oct31.034851.24494@agate.berkeley.edu>, mkkuhner@codon2.berkeley.edu (Mary K. Kuhner;335 Mulford) writes: > My favorite experiment showing the complexity of non-DNA information > in the cell was done with a protozoan which is covered with cilia, > all lined up the same way. Very precise microsurgery was used to > cut a strip off of the cell wall and put it back in reverse. > Somehow the cell survives this, and ends up with a row of backwards > cilia. All descendents of that cell have a similar row, because > the old cell's cilia are used as templates for the new arrangement. This would seem to imply that, at least for unicellular life, Lamarck was not entirely wrong. If protozoa can inherit acquired traits, then won't acquired traits partially direct their evolutionary course, at least in the generative information which is not encoded in their DNA? Has their been any research done to explore this possibility which the microsurgery you describe so well highlights? Russell
pell@boulder.Colorado.EDU (Anthony Pelletier) (11/01/89)
>In article <1989Oct31.034851.24494@agate.berkeley.edu>, mkkuhner@codon2.berkeley.edu (Mary K. Kuhner;335 Mulford) writes: >> My favorite experiment showing the complexity of non-DNA information >> in the cell was done with a protozoan which is covered with cilia, >> all lined up the same way. Very precise microsurgery was used to >> cut a strip off of the cell wall and put it back in reverse. >> Somehow the cell survives this, and ends up with a row of backwards >> cilia. All descendents of that cell have a similar row, because >> the old cell's cilia are used as templates for the new arrangement. In article <7111@cs.utexas.edu> turpin@cs.utexas.edu (Russell Turpin) writes: > >This would seem to imply that, at least for unicellular life, >Lamarck was not entirely wrong. > >Russell Ah...This is an interesting one. The Membrane people have often used it as a case of information in a membrane. But, the key to this positional information may lie in the fact that each of those little cilia are secured to ("grow" out of) a Basal Body (the same as a centriole in animal-cell mitotic spindles). These replicate in an interesting fashion: During vegatative growth, a new BB is built alongside the old one and the position (relative placment and angle) of the new one to the old one is very precise. In some ways, you could say the old BB is a template for the new one. So, you would expect the reverse position of the cilia to be maintained as a function of the placement of the BB. However, it is important to point out that this alterred positional information is NOT passed on through sexual reproduction. People have argued for decades over whether BBs represent an endosymbiont. To that end, there has been for decades a hunt for a genome associated with BBs (as is the case for mitochondria and chloroplasts). The history of this has some amusing highs and lows. David Luck's group (Zenta Ramanis, Susan Dutcher etc.) at Rockefeller showed that in Chlamydomonas there is a linkage group (called Fragment 2, linkage-group 19, or ULG, for Uni Linkage Group--a few mutations on the chromosome lead to cells with one flagellum, hence "uni"). All mutations that mapped to that group affected the basal-bodies and/or the flagella. This linkage group is seriously weird--it maps as a circle but apparently isn't, recombination is temperature sensitive (raise the temp and recomb. increases), it is apparently diploid in the cell, but the genetics behave as a haploid, and, unlike other organelle DNA, it is inherited in a Mendelian fashion. The Oct. 6th issue of Cell has an article from Luck's group (Hall, Ramanis and Luck), and a minireview on the topic (also the cover picture). It seems they have good evidence that the genome IS associated with the BB, and it is linear. They did some RFLP mapping, cloned some of it, and used the clone as a probe on Orthoganal-pulse gels (to show it is a linear molecule of about 6 mb) and in sito hybridization (to show localization to the BB). So, Is it Lamarkian? Well, yes, sort of. The positional information in the above example has nothing to do with altering the DNA of the BB, so it is not a mutation. (If Hall's result holds up, I think it is safe to refer to the DNA of Basal bodies.) But, this is only propogated vegetatively. All you get is a clonal population derived from the original. One might imagine other cases where an acquired change is propogated during Fission-growth. But I can't think of one (other than mutations to DNA, of course) that is propogated sexually. Since none the of species that lead to the Darwinian and Lamarkian models reproduce by fission, one can hardly expect Darwin's rules to account exactly fro that type of reproduction. Interesting stuff. -tony
brianm@cat21.CS.WISC.EDU (Brian Miller) (11/03/89)
In article <1989Oct31.034851.24494@agate.berkeley.edu> mkkuhner@codon2.berkeley.edu.UUCP (Mary K. Kuhner) writes: >A small virus could probably be sythesized quite readily. Man currently lacks the knowledge to create viri from scratch. Modifying existing ones he can do clumsily however. >My favorite experiment showing the complexity of non-DNA information >in the cell was done with a protozoan which is covered with cilia, >all lined up the same way. Very precise microsurgery was used to >cut a strip off of the cell wall and put it back in reverse. >Somehow the cell survives this, and ends up with a row of backwards >cilia. All descendents of that cell have a similar row, because >the old cell's cilia are used as templates for the new arrangement. Fascinating. >Mary Kuhner >mkkuhner@enzyme.berkeley.edu
jda@brunix (Jeff Achter) (11/03/89)
Since DNA determines protein, and protein determines enzyme function, and enzyme function is basically life, theoretically we should be able to craft an organism from scratch. Unfortunately, there are enough holes in our knowledge that this is impractical. Some of the problems include: Gene expression and transcription. A large part of a DNA strand is junk--nucleotides which are never expressed as amino acid sequences. Additionally, we don't know how the transcription enzymes know when to start and stop transcribing a stretch of DNA. There are three possible reading frames on each of the two complementary strands; which will be expressed? Until we know this, we can't reliably craft a genome. Protein structure. This is a biggy. The function of a protein is determined by its three dimensional structure. While progress is being made in biophysics, the models aren't good enough to predict the tertiary and quaternary structure of a protein, given its primary structure (the sequence of amino acids). Thus, it is very difficult to craft proteins with desired functions. Putting everything together. Remember, there are *lots* of different proteins in even the simplest cell. If we build an organism from the bottom up, we have to account for all the different functions a cell needs for survival--transcription, membrane building, energetics catalysis, etc. It would be far easier to build a virus, but... are viruses alive? :-) In short, we're working on it, but not yet. Jeff Achter | PO Box 1320 | jda@cs.brown.edu | Brown University | (this space reserved) uunet!brunix!jda | Providence, RI 02912 | jda@browncs.bitnet | (401)863-6961 |
BCHS1B@jane.uh.edu (11/03/89)
In article <4516@utastro.UUCP>, terry@utastro.UUCP (Terry Hancock) writes: > In article <2461@umbc3.UMBC.EDU> cs225202@umbc5.umbc.edu.UUCP (Sang J. Moon) writes: >>Just a thought... I know that the basic building blocks of DNA can be now >>created from inorganic molecules, but can biologists use these building blocks >>to create viable DNA which will cbecome an actual organism? >> > No, as I understand it, there are some problems: > > 1. We don't yet have the ability to construct arbitrary > sequences of DNA. We are limited to a) simple code > sequences (such as all one type, or sets of three, or > something) or b) copying codes that are found > naturally. > I would be VERY interested in info refuting > this statement, if such exists. > > 2. Even if we COULD do 1., we don't know enough about > molecular biology to make a plan for a viable organism > (unless we copy extensively from an existing one). There > is much study left to be done. > > Caveat -- I am NOT a biologist, I am an astronomer, I get these > silly ideas from my fiancee, who doesn't get the net. I'll have to > ask her about any technical questions. > > ********************************** > Terry Hancock > terry@astro.as.utexas.edu > ********************************** > > Sorry, but that is not correct. We can synthesize DNA containing any sequence that we want it to carry. It is now routine to synthesize entire genes. It certainly would be reasonable, although some effort, to synthesize the genome of a small virus which could be used to transform a cell and then would replicate and propagate itself. The complete DNA sequence has not yet been determined for any living cell, probably the bacterium E. coli will be first in the next few years. It would be theoretically possible to synthesize its genome, but practically it would be unreasonable. However it would not be an easy step to go from this to a living cell becuase you need components of the cell to read and transcibe and replicate the information n the DNA first. Sort of like have a cassette tape without a tape recorder, the information is there but no way to read or hear it. MIke Benedik Biochemical Sciences University of Houston
eesnyder@boulder.Colorado.EDU (Eric E. Snyder) (11/04/89)
In article <19690@brunix.UUCP> jda@cslab9a.UUCP (Jeff Achter) writes: > >Additionally, we don't know how the transcription enzymes >know when to start and stop transcribing a stretch of DNA. There are >three possible reading frames on each of the two complementary >strands; which will be expressed? Until we know this, we can't >reliably craft a genome. Come now, we deserved a little more credit than that. I suggest the following reference: Pribnow, D. (1975) Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter. PNAS 72(3): 784-788. I hope the name rings a bell. --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder Department of Biochemistry Proctoscopy recapitulates University of Colorado, Boulder hagiography. Boulder, Colorado 80309 LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
jda@brunix (Jeff Achter) (11/04/89)
Yes, I know. We *are* making progress. The promoter sites are certainly a step in the right direction. However, to the best of my (admittedly limited) knowledge, given an arbitrary sequence of DNA, we cannot reliably predict which parts will be transcribed. Additionally, there is the related problem of transcription regulation--what governs when new proteins are manufactured, and in what quantities, etc. Jeff Achter | PO Box 1320 | jda@cs.brown.edu | Brown University | (this space reserved) uunet!brunix!jda | Providence, RI 02912 | jda@browncs.bitnet | (401)863-6961 |
toms@ncifcrf.gov (Tom Schneider) (11/04/89)
The question has been raised as to whether we can build life from scratch with our current knowledge and technology. The answer is that we certainly have the technology, but we don't have the knowledge of how to use it. It's as if we had matches and dry paper, but didn't know what to do to get the fire going. But once somebody gets it going, how can we know that they really succeeded and didn't cheat? Well, all living organisms on this planet use chiral molecules, so amino acids come in D and L forms which are mirror images of each other (stereoisomers) but living things use the L form except in rare cases. Likewise B form DNA, the kind used predominantly in cells, is a right handed helix. (Left handed DNA has a different structure.) So a proof that we really can build living things from scratch is to construct a cell that is an entire mirror image of cells that now exist! Let's put some teeth into that! I promise to pay $1000 to anyone who can construct a completely reversed (mirror image) cell! Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21701-1013 toms@ncifcrf.gov
turpin@cs.utexas.edu (Russell Turpin) (11/04/89)
In article <1380@fcs280s.ncifcrf.gov>, toms@ncifcrf.gov (Tom Schneider) writes: > Let's put some teeth into that! I promise to pay $1000 to anyone who can > construct a completely reversed (mirror image) cell! Given the magnitude of the task, the reward you offer is more a weak pair of dentures. Russell
toms@ncifcrf.gov (Tom Schneider) (11/04/89)
In article <7132@cs.utexas.edu> turpin@cs.utexas.edu (Russell Turpin) writes: >In article <1380@fcs280s.ncifcrf.gov>, toms@ncifcrf.gov (Tom Schneider) writes: >> Let's put some teeth into that! I promise to pay $1000 to anyone who can >> construct a completely reversed (mirror image) cell! > >Given the magnitude of the task, the reward you offer is more a >weak pair of dentures. > >Russell (tee hee) well, I guess that puts you out of the running! But seriously, how long do you think this is going to take before I have to fork it over? Tom
wen-king@cit-vax.Caltech.Edu (King Su) (11/04/89)
I have a thought. Rather than to try and synthesize existing life
forms, wouldn't it be simpler to synthesize life forms that might have
existed billions of years ago, when the ocean is just a pool of simple
chemicals? Even the most simple, present-day virus is a challenge to
synthesize. Yet a viron is not really alive until it enters a host that
provides the viron additional components to allow it to reproduce. If
life really came from a pool of chemicals, then there must be an early
form of life that is very simple in structure, and is capable of
reproducing itself without a lot of supporting components. Maybe we can
make such a life form without too much trouble.
--
/*------------------------------------------------------------------------*\
| Wen-King Su wen-king@vlsi.caltech.edu Caltech Corp of Cosmic Engineers |
\*------------------------------------------------------------------------*/muttiah@cs.purdue.EDU (Ranjan Samuel Muttiah) (11/04/89)
Why bother ? There is enough of it around already.
stevelee@csd4.csd.uwm.edu (Just Another Steve (but not dave)) (11/04/89)
In article <8523@medusa.cs.purdue.edu> muttiah@cs.purdue.edu (Ranjan Samuel Muttiah) writes: > >Why bother ? There is enough of it around already. Because it's a challenge. It's something that's never been done. And it's something that will be done (so sayeth I) within the next two decades. -stevelee- Of course I could be wrong. It wouldn't be the first time in my life. |-------------------------------|--------------------------------------------| | Steven Lee Pearson | HISTORY SHOWS AGAIN AND AGAIN HOW NATURE | | stevelee@csd4.csd.uwm.edu | POINT OUT THE FOLLY OF MEN. | | (414) 962-4828 | (from "Godzilla" by the BOC) | |-------------------------------|--------------------------------------------|
muttiah@cs.purdue.EDU (Ranjan Samuel Muttiah) (11/05/89)
In article <762@uwm.edu> stevelee@csd4.csd.uwm.edu (Just Another Steve (but not dave)) writes: >In article <8523@medusa.cs.purdue.edu> muttiah@cs.purdue.edu (Ranjan Samuel Muttiah) writes: >> >>Why bother ? There is enough of it around already. > > Because it's a challenge. It's something that's never been done. > And it's something that will be done (so sayeth I) within the next > two decades. > Wouldn't it be more a challenge to _document_ all the existing life forms ? Let's face it. We only know of 40-50 % of the species that exist let alone document them in detail. What happens to the rest. Do we care ? Are _we_ the environment now ?
stevelee@csd4.csd.uwm.edu (Just Another Steve (but not dave)) (11/05/89)
In article <8525@medusa.cs.purdue.edu> muttiah@cs.purdue.edu (Ranjan Samuel Muttiah) writes: >Wouldn't it be more a challenge to _document_ all the existing life forms ? >Let's face it. We only know of 40-50 % of the species that exist let alone >document them in detail. What happens to the rest. Do we care ? Are >_we_ the environment now ? Yes and no. It would be a grand challenge-but about as realistic as the search for the perpetual motion machine. The problem is not so much the concept of the project-but instead it's the enormity of it. I find it difficult to believe that we really know even 25% of all species of MAMMALS, let alone birds, reptiles, insects, fish, ad infinitum. The beauty of "creating life" is that the techniques needed are coming from scientists not necessarily looking to do it. For example, a molecular biologist studying how and why oncogenes get turned on in cancer cells, is also adding to the pool of knowledge that will some day be used and incorporated into the first forms of "protolife" if you will. Besides, as my .sig states "History shows again and again how Nature points out the folly of men." Every time we would think we've got everything catalogued and filed away, we'd find something new, and realize how few species we really do know about. (Heck, in the bacterial world, new species are arising constantly. But I assume we aren't realy discussing the world of microbes.) -stevelee- |-------------------------------|--------------------------------------------| | Steven Lee Pearson | HISTORY SHOWS AGAIN AND AGAIN HOW NATURE | | stevelee@csd4.csd.uwm.edu | POINT OUT THE FOLLY OF MEN. | | (414) 962-4828 | (from "Godzilla" by the BOC) | |-------------------------------|--------------------------------------------|
mkkuhner@codon1.berkeley.edu (Mary K. Kuhner;335 Mulford) (11/05/89)
I think this debate might prosper if we noticed that "creating life" means two different things in various postings: 1. Making an exact copy of an extant organism out of non-living parts, and without an organism intervening; 2. Making a novel organism. I will argue that (1) is quite possible, if viruses are alive, whereas (2) (aside from simple variations on extant organisms) is a *long* way away. Would reversing the chirality of the entire organism change its chemical properties? I seem to recall reading that it would. Certainly you would have to reverse every chiral molecule involved in the synthesis. We may accomplish (2) eventually, but chirality reversal sounds an order of magnitude harder to me. Mary Kuhner mkkuhner@enzyme.berkeley.edu
baez@x.ucr.edu (John Baez) (11/07/89)
In article <1989Nov5.014949.25863@agate.berkeley.edu> mkkuhner@codon1.berkeley.edu.UUCP (Mary K. Kuhner) writes: > >Would reversing the chirality of the entire organism change >its chemical properties? I seem to recall reading that it >would. Certainly you would have to reverse every chiral molecule > >Mary Kuhner >mkkuhner@enzyme.berkeley.edu Stereoisomers (= chirally reversed molecules) have essentially identical chemical properties except in reaction with other molecules with handedness. (I say `essentially' because the weak (nuclear) force violates parity, but this effect is minute.) Thus if one created all ones ingredients and working tools `from scratch', e.g. from molecules which are left-right symmetric, one could create a chiral-reversed virus the same way as a usual one. If one uses a lot of chiral molecules from existing organisms in doing DNA research it'd be a lot of trouble to synthesize reversed versions of everything... can anyone more knowledgeable on biochem sketch how much work this'd be? While on this subject... is there any up-to-date word out on why the human heart is not left-right symmetric and whether this assymetry is genetically encoded, and how?? This has always fascinated me!
ningluo@marvin.cs.Buffalo.EDU (Ning Luo) (11/08/89)
In article <12500@cit-vax.Caltech.Edu> wen-king@cit-vax.UUCP (Wen-King Su) writes: >I have a thought. Rather than to try and synthesize existing life >forms, wouldn't it be simpler to synthesize life forms that might have >existed billions of years ago, when the ocean is just a pool of simple >chemicals? Even the most simple, present-day virus is a challenge to >synthesize. Yet a viron is not really alive until it enters a host that >provides the viron additional components to allow it to reproduce. If >life really came from a pool of chemicals, then there must be an early >form of life that is very simple in structure, and is capable of >reproducing itself without a lot of supporting components. Maybe we can >make such a life form without too much trouble. >-- >/*------------------------------------------------------------------------*\ >| Wen-King Su wen-king@vlsi.caltech.edu Caltech Corp of Cosmic Engineers | >\*------------------------------------------------------------------------*/ I believe this HAS BEEN ACCOMPLISHED (so-called "evolution in vitro" experiments by Spiegleman (sp?) and his colleagues. You can find the references from M. Eigen's articles a few years back. However, this is NOT a life form in full sense, since it is required to supply the nucleotides, high energy molecule source AND the enzyme (RNA polymerase), just like a viron or a virus dependent on its host, a living organism, to provides these supplies. So, before we talk about "creating life", we have to have a clear consensus about "what is life"? Or, for the sake of simplicity, "what is the minimal life"? The discussion about "what is life" as a scientific question can very easily metamorphose into a purely metaphysical debate. To be specific, let's adopt Eigen's view: Life begins when a set of macromolecules establish an enclosure of replicating themselves in the presence of only "small" molecules. "Small" here could mean nucleotides, ATP's, amino acides, etc.. People studying the origin of life are still having a hard time to find a primordial condition in which the concentrations of the precursor small molecules could be maintained high enough so that the polymerizations could take place spontaneously. But, let's put this issue aside for the moment, and let's assume that such a condition "somehow" occurred on the primordial earth. We may never know what this condition exactly is, and may never be able to re-generate life in the same fashion. But, we may find other conditions in which some set of macromolecules could reproduce themselves from small molecules. If we achieve this, we can say: We have created a life form. Now is the quiz time: Could the virus or the worms in the computer world be considered as a life form in a general sense? After all, this is an "autopoietic" form in a world of bits and bites. Luo, Ning Dept. of Physics SUNY Buffalo Amherst, NY 14260 | ningluo@marvin.cs.buffalo.edu (APARNET)