eesnyder@boulder.Colorado.EDU (Eric E. Snyder) (11/14/89)
In article <1030@uwm.edu> stevelee@csd4.csd.uwm.edu (The Anti-Theist Named Steve) writes: > But, to be honest, I would think a strong mutagen like ethidium > bromide, which interferes with replication by getting into the > spaces between the strands of the double helix, causing a > misreading in the replication and transcription process. > > Where ethidium bromide would be better as a weapon is that: > > (a) it needs no outside solvent to do some serious mutagenic > damage. Ok, net people, just how dangerous is ethidium bromide? I get shit in the lab constantly for slopping my gel buffers all over the place.... I under- stand that it was used in vet medicine for a time as against trypanosomes... in fact, the Merck Index even reports it as being "bitter tasting". How does it compare to real nasty compounds like benzanthracenes and nitrosomines? Is this just another case of oversensitive molecular biologists? Funny how no one seems to be bothered much by 32P! --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder Department of Biochemistry Proctoscopy recapitulates University of Colorado, Boulder hagiography. Boulder, Colorado 80309 LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
werner@aecom.yu.edu (Craig Werner) (11/15/89)
In article <13854@boulder.Colorado.EDU>, eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes: > In article <1030@uwm.edu> stevelee@csd4.csd.uwm.edu (The Anti-Theist Named Steve) writes: > > Ok, net people, just how dangerous is ethidium bromide? I get shit in the > lab constantly for slopping my gel buffers all over the place.... Shame on you. Stop slopping you buffers. In New York, Agarose gels with Ethidium in them count as ethidium waste and need to disposed of separately. Not so in Connecticut, they're just normal trash. Only Ethidium/Cesium gradients require the special treatment. Of course it is a matter of amounts, I average approximately 1 mg per year,. maybe two, in ethidium stained gels ( 8-12 ul of 1 mg/ml per gel. That's several hundred gels a year. Yes, it's carcinogenic. Yes, it makes you glow in the dark. Yes, it breaks down over a period of time in the environment. No, it doesn't really pass through the skin very well, and of course, the skin is dead anyway. Still, I wear gloves when I open the tube, but not necessarily all the time when I touch the gel. It gets about the same respect as 35S. ~. -- Craig Werner (future MD/PhD, 4.5 years down, 2.5 to go) werner@aecom.YU.EDU -- Albert Einstein College of Medicine (1935-14E Eastchester Rd., Bronx NY 10461, 212-931-2517) "My philosophy, like color TV, is all there in black and white."
jay@banzai.PCC.COM (Jay Schuster) (11/17/89)
werner@aecom.yu.edu (Craig Werner) writes: >In article <13854@boulder.Colorado.EDU>, eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes: >> In article <1030@uwm.edu> stevelee@csd4.csd.uwm.edu (The Anti-Theist Named Steve) writes: >> >> Ok, net people, just how dangerous is ethidium bromide? I get shit in the >> lab constantly for slopping my gel buffers all over the place.... > > Yes, it's carcinogenic. Yes, it makes you glow in the dark. Yes, >it breaks down over a period of time in the environment. I had a lover who was a graduate student in toxicology once. His advisor (to him) was the embodiment of evil (as Theodore Strelesky's was to him, I imagine). He always had plans to exact his revenge by putting Ethidium Br in his advisor's coffee. It would be a while before he got cancer, and it would be the perfect cover up, since no one is going to investigate the cause of the cancer, and anyone in a biolab/chemlab is exposed to enough nasties. I was told by another grad student (as an undergrad) that the ability of Ethidium Br to intercalate between base pairs of DNA was not enough to explain how potent a carcinogen it was. This was in 1983. -- Jay Schuster <jay@pcc.COM> uunet!uvm-gen!banzai!jay, attmail!banzai!jay The People's Computer Company `Revolutionary Programming'