eesnyder@boulder.Colorado.EDU (Eric E. Snyder) (10/17/90)
A friend of mine came up with a statement that struck me a patently absurd.... "there is no evidence of angiosperms (flowering plants) in the fossil record" I feel an little embarrased asking but, is this true? On a related note: there was a paper (in Nature?) recently in which a cytochrome gene was PCR'd from a fossilized plant... was this a flowering plant? (and does anyone have a ref?).... --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder Department of MCD Biology We are not suspicious enough University of Colorado, Boulder of words, and calamity strikes. Boulder, Colorado 80309-0347 LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
elmo@uhura.cc.rochester.edu (Eric Cabot) (10/18/90)
In article <28272@boulder.Colorado.EDU> eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes: >A friend of mine came up with a statement that struck me a patently >absurd.... > >"there is no evidence of angiosperms (flowering plants) in the >fossil record" > >I feel an little embarrased asking but, is this true? On a related This is indeed untrue, as evidenced, for example by the article that you refer to. >gene was PCR'd from a fossilized plant... was this a flowering plant? >(and does anyone have a ref?).... > The paper *was* in Nature and the plant was a Magnolia,which is indeed a flowering plant. If I`m not mistaken the gene wasn't a cytochrome, but rather Ribulose-1,5-bisphosphate carboxylase, or rubisco (or Rbc) for shorter. -- =+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+= Eric Cabot | elmo@{uhura | db1}.cc.rochester.edu "insert your face here" | elmo@uordbv.bitnet =+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=
frist@ccu.umanitoba.ca (10/18/90)
In article <28272@boulder.Colorado.EDU> eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes: >A friend of mine came up with a statement that struck me a patently >absurd.... > >"there is no evidence of angiosperms (flowering plants) in the >fossil record" > >I feel an little embarrased asking but, is this true? On a related Your friend is probably a Special Creationist. While Gymnosperms dominated much of the first parts of the Mesozoic era (Triassic and Jurassic), starting in the Cretaceous period (roughly 130Myr ago), the angiosperm radiation can be observed. During this period, mass extinctions of gymnosperms occurred, so that there are today fewer than 1000 species of gymnosperms. In contrast, most of the plants species we see today are angiosperms. =============================================================================== Brian Fristensky | "What IS the secret of life?" I asked. Dept. of Plant Science | "I forgot," said Sandra. University of Manitoba | "Protein," the bartender declared. "They Winnipeg, MB R3T 2N2 CANADA | found out something about protein." frist@ccu.umanitoba.ca | Office phone: 204-474-6085 | FAX: 204-275-5128 | from CAT'S CRADLE by Kurt Vonnegut ===============================================================================
sarima@tdatirv.UUCP (Stanley Friesen) (10/20/90)
In article <28272@boulder.Colorado.EDU> eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes: >A friend of mine came up with a statement that struck me a patently >absurd.... > >"there is no evidence of angiosperms (flowering plants) in the >fossil record" > >I feel an little embarrased asking but, is this true? Nope! There a quite a few fossils of flowering plants. There are even a fair number of fossils flowers (which is not the same thing, but is the strongest evidence). In addition there is abundant fossil pollen which has a form found only in flowering plants, and essentially all experts agree that it is indeed flowering plant pollen. (This is reinforced by the fact that more recent fossil angiosperm pollen is more similar to that of modern angiosperms than the older stuff). There are also numerous fossil seeds and fruits, including elm seeds, maple seeds, rose hips &c. Finally, fossil leaves attributed to angiosperms are known from the middle of the Lower Cretaceous, mostly from Delaware. (Leaves are a little difficult to identify accurately, so they are less powerful evidence). For a good start any general text on palynology will probably do. -- --------------- uunet!tdatirv!sarima (Stanley Friesen)
UNASMITH@pucc.Princeton.EDU (Una Smith) (10/22/90)
eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes: >>A friend of mine came up with a statement that struck me a patently >>absurd.... >>"there is no evidence of angiosperms (flowering plants) in the >>fossil record" Not true. frist@ccu.umanitoba.ca writes: >Your friend is probably a Special Creationist. While Gymnosperms dominated >much of the first parts of the Mesozoic era (Triassic and Jurassic), >starting in the Cretaceous period (roughly 130Myr ago), the angiosperm >radiation can be observed. During this period, mass extinctions of There is evidence of a similar radiation (enormous diversification and increase in numbers) of _insects_, which makes for a very nice story about coevolution. [stuff deleted] - Una UNASMITH@PUCC : BITNET unasmith@pucc.Princeton.EDU : Internet una@tropic.Princeton.EDU : Internet
kuento@kuhub.cc.ukans.edu (10/22/90)
In article <11928@pucc.Princeton.EDU>, UNASMITH@pucc.Princeton.EDU (Una Smith) writes: > eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes: >>>A friend of mine came up with a statement that struck me a patently >>>absurd.... > >>>"there is no evidence of angiosperms (flowering plants) in the >>>fossil record" > > Not true. > > frist@ccu.umanitoba.ca writes: >>Your friend is probably a Special Creationist. While Gymnosperms dominated >>much of the first parts of the Mesozoic era (Triassic and Jurassic), >>starting in the Cretaceous period (roughly 130Myr ago), the angiosperm >>radiation can be observed. During this period, mass extinctions of > > There is evidence of a similar radiation (enormous diversification and > increase in numbers) of _insects_, which makes for a very nice story > about coevolution. To be more specific, the Lepidoptera (butterflies/moths) and Hymenoptera (wasps/bees) showed the most dramatic "explosions" - The speed of diversification in the bees, for example, must have been incredible (on a geologic scale) because the entire superfamily originated after/with flowers (bees feed their young with pollen, and the primary synapomorphies all relate to pollen-carrying), and there were already *highly* social bees from modern genera 80 million years ago (the oldest fossil bee, in fact - a Trigona stingless bee in amber). In other words, it would appear that the bees had pretty much evolved most of their lineages by the mid-Cretaceous (there are some 30,000 species today). > - Una UNASMITH@PUCC : BITNET > unasmith@pucc.Princeton.EDU : Internet > una@tropic.Princeton.EDU : Internet -- ---------------------------------------------------------------- Doug Yanega (Snow Museum, Univ. of KS, Lawrence, KS 66045) My card: 0 The Fool Bitnet: Beeman@ukanvm Disclaimer? Ha! Have opinion, will travel...