gwilliam@crc.ac.uk (Gary Williams x3294) (03/09/91)
G-NOME NEWS
-----------
The Newsletter of the UK Human Genome Mapping Project
Number 5 Winter 1991/91
Editors: Nigel K. Spurr
Enquiries to:
Nigel K. Spurr,
ICRF Clare Hall Laboratories,
Blanche Lane,
Potters Bar,
South Mimms,
Herts. EN6 3LD
Tel: 0707-44444, Ext. 353
Contents: Page No.
1) Editorial - Nigel Spurr 2
2) Call for Contributions 3
3) HGMP Resource Centre - Tony Vickers 4
4) The Human Cell Bank at CAMR, Porton 7
5) European Community Human Genome Analysis Programme 9
6) HGMP Senior Fellowship 11
7) Human Genome and Related Research in London 12
i) MRC Clinical Research Centre 12
ii) Imperial Cancer Research Fund 17
a. Director's Laboratory
b. Laboratory of Human Molecular Genetics
c. Human Immunogenetics Laboratory
d. Genome Analysis Laboratory
e. Human Cytogenetics Laboratory
f. Molecular Analysis of Mammalian Mutation Laboratory
iii) Research Interests at Charing Cross 20
iv) St. Bartholomew's Hospital 20
v) St. Mary's Hospital Medical School 20
vi) Institute of Child Health 22
vii) Mount Vernon Hospital 23
viii) The Galton Laboratory, University College London 23
ix) University College & Middlesex School of Medicine 25
a. Department of Psychiatry
b. Department of Medicine
x) Royal Postgraduate Medical School, Hammersmith Hospital 26
xi) United Medical and Dental Schools of Guy's and St. Thomas's
Hospitals 27
xii) Institute of Neurology 29
xiii) London School of Hygiene and Tropical Medicine 29
xiv) Imperial College of Science Technology and Medicine 29
8) The European Collaborative Interspecific Backcross - A Facility 31 for
Mapping the Mouse Genome - Stephen Brown
9) Oligonucleotide Primers for PCR Analysis of Mouse 33 Microsatellites - John
Todd
10) Directed Programme Awarded Project Grants - Dr. Furzana Bayri 34
11) 1991 HGMP Research Studentship Awards 36
Appendix I: List of contributors 38
Appendix II: Mouse Chromosome Specific Microsatellites table 42
1) EDITORIAL
Nigel Spurr
Imperial Cancer Research Fund
Clare Hall Laboratories
Blanche Lane
South Mimms, Potters Bar, Herts. EN6 3LD
G-NOME News has now reached its fifth issue and has been well received
in the Human Genome Mapping Project community. We also have a larger
readership with many diverse interests. At present, it is still a UK venture
though the mailing list now has nearly 600 names including many individuals and
groups in the rest of Europe and the USA. To acknowledge the increasing
readership and influence of the European Community and the establishment of the
EC Genetic Analysis programme the next issue will concentrate on research in
the rest of Europe. Already many contributions have been received for this
issue.
The current edition concentrates on research interests in London. The
reports cover a wide range of interests and I have not attempted to write any
text unifying them. They stand as short reports of current research and show
both a high level of activity in the mapping of specific disease genes as well
as methods to order and link clones along specific chromosomes.
This year the 11th International Workshop on Human Gene Mapping meeting
will take place in London, 18-22 August. Further details on abstracts and
attendance will follow in the next Newsletter. There are a limited number of
places available, around 750, and attendance will be by the acceptance of an
abstract only. This obviously will be a major opportunity to show the world
community the depth and quality of human genome research in Europe.
In the next two months, the HGMP Resource Centre based at the CRC,
Northwick Park, will have a number of new facilities available. These are
outlined elsewhere in this Newsletter. The UK DNA Probe Bank has now been
completely transferred from ICRF Clare Hall to the HGMP Resource Centre. A
number of samples have been sent out and catalogues listing the 600 plus probes
are now available in a printed form or on-line at the Resource Centre via
JANET. Similarly an oligonucleotide primer synthesis has been established and
a YAC screening and cDNA cloning and sequencing services are scheduled to
follow soon.
My thanks in particular go to John Todd and his colleagues in Oxford
for allowing us to publish a selection of oligonucleotide primer pairs
detecting highly informative mouse microsatellites. There are approximately
two primer sets for each mouse chromosome, some unpublished previously and
these are being used as index/reference/anchor markers for the mouse genetic
linkage map currently under construction (see article on European collaborative
project by Steve Brown). All of these primers will be available free to UK
registered users; for those interested outside the UK, it is anticipated that
the primers will be available in a kit for purchase in the next few months.
For further information contact Dr. Gabrielle Fisher at the HGMP Resource
Centre (Tel.No: 081-869 3446).
If you wish to contribute articles for publication in the Newsletter,
please send your contributions as detailed in Section 2 below. These can be
useful primer sequences for PCR, technical tips, technique modifications etc.
or articles of general interest to the HGMP community. One area where I have
been asked to solicit articles is from the recipients of Human Genome Project
grants from the MRC. These will outline the use to which these have been put
and any valuable developments coming from this extra funding. We are also
aiming to produce a series of articles on particular techniques including
strengths and weaknesses. The next issue will contain articles on mutation
analysis. If you have a novel technique or are interested in contributing to
these articles please contact me as soon as possible.
Finally may I wish everyone a happy and successful New Year.
2) CALL FOR CONTRIBUTIONS
The UK Human Genome Mapping Project would welcome contributions from
the HG community, to their quarterly newsletter, G-NOME NEWS.
Please send any articles to Dr. Nigel Spurr, ICRF, Clare Hall
Laboratories, Blanche Lane, South Mimms, Herts, EN6 3LD. Contributions can be
accepted in any form viz: written, fax (0707-49527), disc (any format, but
preferably 3.5" discs), or by e-mail (N_Spurr @ UK.AC.ICRF).
The deadlines for receipt of copy are as follows:
Winter Spring Summer Autumn
10.1.91 9.4.91 10.7.91 10.10.91
3) HGMP RESOURCE CENTRE
Recent developments in the services offered from the Resource Centre
have been reported in notes circulated to all registered users. As things
evolve, this issuing of notes will continue and the quarterly publication of
G-NOME NEWS will be used to sum up the position. We are worried by reports
that there are still pockets of workers totally unaware of the existence of the
Resource Centre (or perhaps even of the HGMP). There are certainly
more-or-less major departments in which either no-one has registered or the
sole registered user is the head of department. Our hope is that everyone -
from graduate students to Fellows of the Royal Society - with a significant
interest in the human genome will register; even if they do not want to use
anything we have (or will have) to offer, at least we can get them on our
mailing list.
Registration forms are available from Christine Bates (081-869 3446) or
Joanne Grewcock (081-869 3805).
Yac libraries
We now have the St. Louis library at the Resource Centre, and during
January the ICI library will be brought here too. Kay Davies and David Bentley
are developing the screening technology, and everything is on course for us to
meet the specified objective of having a screening service on-stream by the end
of February. David Bentley's group report on their approach to YAC screening
in this present issue of G-NOME NEWS. Until the service is launched, we can
offer a B-test service on a limited scale: telephone Ross Sibson on 081-869
3803.
The European Community Genome Analysis Programme is funding
free-of-charge screening by five groups: CEPH, ICRF, Pavia, Leiden and the
Resource Centre. All screening data will be accumulated in a single database.
CEPH will issue DNA pools of their own library; ICRF will issue gridded filters
of DNA from the Lehrach/Monaco library, Pavia and Leiden will offer screening
of libraries as yet undetermined (probably the St. Louis one); the Resource
Centre will offer in-house screening using the St. Louis and ICI libraries.
The centres will be paid by the EC for the screenings they actually do, and we
are all waiting for Brussels to issue the contracts and authorizations for the
service to begin and for the money to start flowing. It is obviously important
that full use is made of this EC-funded service. Unfortunately, the imminent
availability of this reimbursement means that owners of libraries may be
unenthusiastic about doing screening for people at the moment.
Computing
At long last, we have the licence to run GDB. The recent X-Chromosome
Workshop organized by Kay Davies and Ian Craig in Oxford gave a chance to try
out the system in more natural circumstances than at HGM10.5. We have a
programme of one-day training courses in the routine use of GDB (and OMIM and
GBase). Mary Jennings and Julia White from the HGM11 team are running these
courses, which are prefaced by a day's introductory course, about the use of
the Resource Centre's facilities generally, for those who are unfamiliar with
the system. The two run so far depended on direct access to GDB in Baltimore
via the so-called "Fat Pipe" trans-Atlantic link, which distinguished itself on
each occasion by springing a leak (at the US end). Now we have GDB at the
Resource Centre, those problems should be just bad memories.
The problem of editing access - for Chairs and Co-chairs of the
Chromosome committees - remains a cause of some concern. If the objective of
getting data entered more-or-less continuously, rather than at biennial
jamborees, is to be attained, procedures and practices are going to have to be
defined a good deal more precisely than at present. The apparent fraility of
the Fat Pipe is another worry if editing access requires reliable contact
direct with Baltimore. Although HGM10.5 was accounted a success, it was
perhaps over-optimistic to assume that everyone would be able to go away and
use the system, confident both of their own competence and of the robustness of
the system. We are planning a workshop for European Chairs and Co-chairs, to
establish a 'real-world' familiarity with the system. All those we have
identified will receive an invitation.
For information about these courses (and the continuations of the longer
courses previously run in Cambridge but now at Northwick Park) phone Christine
Bates on 081-869 3446.
We are grateful to the officers of Johns Hopkins University and the
Medical Institute for providing the licence to run GDB and to reproduce the
manuals. The Resource Centre's own computing manual has just been revised and
substantially rewritten and increased in scope; the earlier version does not
cover all the facilities now on offer. The Resource Centre manuals will be
sent to registered users shortly; the GDB manual is a large volume that is very
expensive to reproduce, and we shall send one copy to each department,
additional copies will be available at a cost of #15 each (including postage
and packing).
HUMAN GENOME MAPPING WORKSHOPS
HGM10.5 was held in Oxford last year and will be followed by HGM11 in
London during the summer of this year. The UK HGMP has recently made a
substantial contribution to the costs of the computing developments needed to
run these meetings, and, especially, to launch GDB at HGM10.5. The Wellcome
Trust has very generously agreed to share with the Council the expense of this
subvention.
RESOURCE SHARING
Do you have probes, cell-lines or whatever to share? HGMP grant-holders
are required to share data and resources, as one of the conditions of these
awards. In many cases, the sole (or a major) reason for the award has been
precisely to generate accessible resources. It would be nice not to have to
chase people. There is no formal definition of how long someone can have
private use of resources they generate with HGMP funding. Certainly, once the
work is published the resources have to be made available without delay. Where
the purpose of the award was to provide resources, then the contract requires
them to be passed on as soon as practicable. John Todd's mouse microsatellite
primers are a case in point, where rapid delivery has been achieved.
Please let us know (ideally by fax on 081-869 3807) if and when you
have resources to share.
CHROMOSOME 11
Recently, Veronica van Heyningen, David Porteous and David St. Clair - all of
the Human Genetics Unit in Edinburgh - have floated some specific ideas for
co-ordinating work on chromosome 11: the aim is "to further the communication
of information, nurture collaborations and avoid redundancy of effort".
Specific initiatives include establishing a panel of break-point hybrids for
regional mapping (such as already exist for some other chromosomes, eg. 21);
exchanging information about probes and other reagents; and identifying as many
as possible of the people with an interest in the chromosome. For further
information, contact one of the above: the Unit's telephone number is 031-332
2471 and fax 031-343 2620.
Cataloguing and documentation of probes, cell-lines and whatever are
problems that the two Resources Subcommittees of the Joint Scientific Advisory
Board identified almost two years ago. We are addressing them in the specific
context of the collection of cytogenetic abnormalities being organized by
Maggie Fitchett at Oxford, as a joint exercise between the HGMP and the
Association of Clinical Cytogeneticists. The objective is to have a standard
cheap-and-cheerful user-friendly format of database that can be made available
in a run-time version for anyone who wants to have a simple PC-based
cataloguing system. This is not a particularly exciting concept in computing
terms: if your computing expert wants to set up your database in anything more
interesting (Sybase, Oracle or whatever) ask beforehand what the total bill
will be (and get the reply in writing) and find out why something simple will
not serve the purpose.
EQUIPMENT
Having spent six years, since emerging from the peace of MRC Headquarters, in
managing research groups, I have been especially intrigued by the relationship
between equipment manufacturers and scientists. A nice example was when one of
the groups purchased a major item, costing 50,000 Pounds or so. For months the
scientists struggled to make it work; the psychodynamics were that the
manufacturer effortlessly established dominance: the scientists unquestioningly
accepted that the machine's non-performance was their own fault and that making
it work was their responsibility. Any suggestion that the machine or the
design might be inherently defective was met by the retort that X and Y had
bought machines and were delighted with them. The time came when I telephoned
X and Y and found that they had both failed to make their machines work and had
simply let the matter rest there without protest. In other words, each had, in
effect, written off 50,000 Pounds just like that. Armed with that information
- and despite pleas of the "Let's give it another month ..." sort, we went to
the manufacturer and insisted that they make materials to a reasonable
specification on our machine; when that exercise failed, the challenge moved to
their carrying out the exercise on one of their own machines. When that in
turn was a total flop, we successfully demanded our money back, with
compensation for all the wasted time and reagents. But it was made clear to us
that we were not behaving in the spirit of the game.
My interest has been acute whilst the Resource Centre has been kitted out.
Sadly, it has been the exception rather than the rule for anything to work
faultlessly from the word go. Some pieces of equipment could not possibly ever
have worked. Others have worked acceptably only after repeated visits from
service engineers. Others break down repeatedly. The implication is that the
user is the quality control. Any manufacturer of household appliances or cars
who took such an attitude these days would rapidly go out of business. Yet the
prices of most items could be justified only by Rolls-Royce quality of design
and engineering. There have been some shining exceptions to these criticisms.
That, in itself, makes the failures all the more depressing.
Other sources of interest are manufacturers who include in warranties, clauses
that try to exclude the customer's normal legal rights; again, that cavalier
attitude has long since been unacceptable in the everyday world and would
probably not stand up in court. The Consumers Association would have a field
day with the scientific equipment industry. It may be that there is a place
for a "Which?" in the laboratory. If anyone has good stories that might save
others wasting time and money, telephone Clive Gilchrist at the Resource Centre
(081-869 3535).
4) THE HUMAN CELL BANK AT CAMR, PORTON
The Human Cell Bank began to operate with funding from the HGMP in May
last year. A Liaison Committee has been set up to monitor the Bank's
operations and advise management both of the Bank and of the HGMP; the
scientific members are Gary Brown, Malcolm Ferguson-Smith, Veronica van
Heyningen and Bob Williamson.
It became clear that the greatest immediate interest was in the
transformation service and that the biggest users were people who wanted to
establish large numbers of cell-lines from disease-families. Although the
Project Management Committee accepted that a Human Cell Bank be funded, they
were always concerned that the use of the funding should be for purposes
central to the interests of the HGMP; establishing large collections of
disease-families was something that was of dubious value as a communal resource
(although it was accepted that there was something to be said for everyone
interested in a particular disease using the same families). We let the
unrestricted access run for a while, with the explicit warning that we might
have to limit free-of-charge access if the volume of traffic got too great.
That proved to be the case, and the Project Management Committee, advised by
the Directed Programme Committee and by the Liaison Committee for the Cell
Bank, have decided that the ground-rules set out below should apply.
1. The Human Cell Bank is an organization independent of the HGMP, and it can
supply services and cells to anyone who is prepared to pay: for details of
services and charges, apply directly to the Bank at the PHLS Centre for Applied
Microbiology and Research, Porton Down, SALISBURY, Wilts. SP4 0JG (Tel:
0980-610391; Fax: 0980-611315).
2. To use the preferential terms applying to HGMP users, you must be a
registered user (and accept the consequential obligations).
3. Small requirements - say up to 10 transformations a year - will be dealt
with on a de minimis basis and normally dealt with free of charge.
4. People providing cytogenetic abnormalities, eg. as part of the ACC
collection, will have the blood sample processed and lymphocytes stored
(free-of-charge, of course); periodically, a Panel, made up of HGMP scientific
nominees on the Liaison Committee will consider the list of accessions and
decide which of the cells should be transformed. The depositor will receive an
ampoule of transformed cells, as a quid pro quo, and the line will be put in
the catalogue for distribution.
5. Those wishing to make extensive use of the transformation service, eg.
from disease-families, should make a written proposal to the Resource Centre,
indicating how many samples are proposed over what time-span and arguing a
scientific case, in terms, for example, of the benefits of having a collection
of cells from the disease in question. The Liaison Committee Panel will then
decide whether the specimens should be transformed free-of-charge, or a charge
of #25 per sample made, or the full list price for the service charged. In
each case, the costs of packing and delivery will be charged to the customer.
6. Anyone benefiting from the preferential charging structure will be required
to allow the lines to be made available to other registered users without
constraint and must provide appropriate documentation of the cells.
7. No charges will be levied retrospectively, but samples that have already
been deposited but not processed will only be taken as far as the preservation
of lymphocytes. The Panel, referred to in section 5 above, is deciding which
of the disease-families should be accepted as relevant to the interests of the
HGMP. Except insofar as the panel agrees to free-of-charge transformations in
a particular case, each depositor will then be asked whether he or she wishes
to pay the costs of transformation at a level decided by the Panel (ie. either
25 Pounds per line or the full commercial charge). If not, then the
untransformed cells will simply be archived, in case of any future requirement
for them.
We very much regret having to restrict this service, but at 25 Pounds
the charge for transformation is still outstandingly good value for money.
THE USERS' MEETING 1991
The Users' Meeting this year will be held on 19th April at the Royal
College of Physicians (at the South-east corner of Regent's Park). We plan to
begin at 11 o'clock, with a scientific programme in the morning, concentrating
on presentations from HGMP award-holders. After a buffet lunch, there will be
a guest lecture, followed by presentations and discussions about topics such as
single chromosome workshops, the US and EC programmes, the developing cDNA
programme, and so on.
All registered users will shortly get an invitation.
5) EUROPEAN COMMUNITY HUMAN GENOME ANALYSIS PROGRAMME
The January 15 1991 deadline for submission of applications in response
to the 'open call for proposals' has now passed, but applications to the
training programme can be made at any time. This article provides a brief
explanation of the training programme for the EC Human Genome Analysis
Programme.
Scope of the EC Human Genome Analysis Programme
* Improvement of the human genetic map; collection and mapping of the DNA of
large families, in order to provide well-characterised genetic material and
sets of probes to determine the location of the relative position of genes on
the chromosomes
* Physical mapping and ordered clone libraries of the human genome; cosmid
libraries of human chromosomes; screening of YAC libraries from the human
genome; establishing overlapping clone libraries; (limited) sequencing of cDNA
* Improvement of the methods and basis for the study of the human genome - (eg.
technologies to facilitate genetic mapping; techniques for long-range physical
mapping; interpretation of the biological or clinical significance of human
genome data; methods for specific diagnosis of severe genetic defects)
* Databases useful for human genome analysis (eg. for genetic and physical
maps, ordered clone libraries and sequences); software tools for data analysis
and database access; novel computing methods for data interpretation
Aims of the training programme
* to promote and develop the training of young European scientists
* to facilitate the exchange know-how between laboratories interested in
analysing the human genome
* to establish collaborative contacts between laboratories in order to
reinforce the transfer of advanced technologies into laboratories, in
particular to Member States in which these techniques are currently
underdeveloped.
Financial support
Financial support will be in the form of
* BURSARIES to researchers, accompanied by SUBSIDIES to the host institutions;
for a period up to 2 years maximum.
* GRANTS to institutions playing host to the research workers.
A bursary consists of a flat rate monthly sum designed to cover the mobility
and subsistence expenses of the bursary-holder. Two types of bursary are
available:
- young scientist, for those who hold a university degree requiring at least
four years of study (Diploma in Germany, licence or ingneur civil in Belgium,
laurea in Italy, MSc in the UK and Ireland, DEA in France, etc.); - experienced
scientist, for those who hold a doctorate or who have at least four years
professional experience after completion of the university studies (see
paragraph on young scientists).
The subsidy accompanying the bursary is paid to the host institution to cover
overheads and research expenditure. At least 30% of the subsidy must be set
aside to defray the bursary-holder's expenses in connection with missions
and/or attendance at relevant European Conferences etc. A 5000 ecu (approx.
3500 Pounds) subsidy is paid in the case of young scientists; 10,000 ecu
(approx. 7000 Pounds) in the case of experienced scientists.
A grant takes the form of financial support to the host institution, so as to
enable a researcher to join a research team for the purpose of carrying out a
project. The amount of the grant is set by the Commission, on the basis of a
proposal by the host institution and, if necessary, by negotiation. The grant
arrangement is particularly suitable for researchers who already have a
contract of employment or other income for research work, so that the bulk of
the salary costs will be paid by the laboratory from which they originate, and
not by the host laboratory. Applicants intending to pursue the grant procedure
are strongly advised to discuss their plans with the Commission before
submitting an application.
Eligibility of candidates
* At the moment the grants are awarded only to nationals of the Member States
of the European Communities.
* The training through research must take place in a country other than the
country of origin of the applicant or the country where he/she normally resides
(at the time of writing only laboratories located in the Member States of the
European Communities can function as host laboratories).
Application procedure/further information
* Applications may be submitted at any time (submissions arriving before 1
March will be judged in April, submissions arriving before 1 September will be
judged in October)
* The selection committee will meet twice a year (normally in April and
October)
A "Guide to sectoral grants in science and technology" is available from the
following address:
A. Klepsch
CEC - DG XII/F6
"Human Genome Analysis"
200, rue de la Loi
B - 1049 Brussels
tel: 010 322 235 0749
fax: 010 322 235 5365
It contains the general rules governing the scheme for bursaries/subsidies and
grants, and one set of application forms.
In the UK the Medical Research Council takes the lead for this EC programme, on
behalf of the Department of Education and Science. UK readers with general
enquiries about the EC Human Genome Analysis programme should contact the
International Section
Medical Research Council
20 Park Crescent
London W1N 4AL
fax: 071 436 6179
6) HGMP SENIOR FELLOWSHIP
These awards are aimed at providing secure personal employment for a
period of six years for exceptionally talented scientists working in the area
of genome mapping. These awards are designed to retain in the UK, or attract
back from abroad, highly talented scientists by offering them both some degree
of personal security and the means to set up their own group.
Dr. Peter James Scambler (Department of Biochemistry and Molecular Genetics,
St. Mary's Hospital Medical School, London) was awarded an HGMP Senior
Fellowship by the HGMP Senior Fellowships Panel in December 1990 to work on a
project entitled "Regional and fine mapping of two regions of the human genome
associated with aneuploidy syndromes".
7) HUMAN GENOME AND RELATED RESEARCH IN LONDON
i) MRC CLINICAL RESEARCH CENTRE
Division of Molecular Medicine
The molecular genetics of apolipoprotein B (James Scott and colleagues)
This part of the Division has a range of interests aimed at
understanding the molecular genetics of apolipoprotein (apo) B. Apo B is the
principal cholesterol-carrying protein in the blood.
Project 1: The apo B gene is unique among nuclear genes in higher eukaryotes,
in that the mRNA encoding apo B undergoes editing, which leads to the
[production of two forms of apo B that have different roles in the metabolism
and transport of lipid in the circulation. The Division is using molecular
genetic and biochemical approaches to characterise the editing activity. It is
made up of a complex of different proteins and has a necessary RNA component.
This editing process presumably reflects an ancient biological process, which
must have its origins in other biological mechanisms. The Division pursuing
the genes that encode the editing activity in mammals, with the objective of
defining the biological origin and importance of this mechanism.
Project 2: The Division is concerned with the identification of genes involved
in the biosynthesis of apo B-containing lipoproteins. Two distinct genetic
abnormalities affect apo B biosynthesis. These are the conditions
abetalipoproteinaemia and chylomicron retention disease. Genetic studies have
shown that neither of these conditions are due to defects of the apo B gene.
Both are considered to be defects of proteins specially required for the
biosynthesis and secretion of apo B-containing lipoproteins. Genetic and more
traditional biochemical mechanisms are being used to purse these genes.
Project 3: The Division is interested in familial combined hyperlipidaemia.
This is the commonest inherited abnormality of lipid metabolism. It is
responsible for 10% of all episodes of coronary heart disease occurring before
the age of 60. It is therefore a major disease problem. The Division has
established that despite phenotypic homogeneity, the disorder is caused by
major gene abnormalities occurring at at least three loci. We have established
that a single allele operating at or near to the apo AI/CIII/AIV locus on
chromosome 11q23-q24 is responsible for a substantial subset of individuals
with this disorder. Currently the Division is seeking to identify the mutation
and other possible mutations causing this disorder. Gain of function operating
at the level of transcription of the apo CIII gene is the most likely candidate
for the cause of this disorder. In addition, the Division has established that
s subset of individuals with defects of the lipoprotein lipase gene have the
familial combined hyperlipidaemia phenotype. A significant subset of
individuals have defects at neither of these loci, so that candidate genes and
highly polymorphic VNTR and microsatellite repeats are being used to purse the
other locus or loci. The resources of the human Genome Resource Centre at the
Clinical Research Centre are a major asses in pursuing these goals.
Greig cephalopolysyndactyly syndrome (Martin FARRALL)
Greig cephalopolysyndactyly syndrome (GCPS) is a rare inherited
disorder resulting in abnormal craniofacial and limb development and has been
localized to human chromosome 7p13. The mouse mutation extra-toes (Xt) is a
likely homolog of GCPS. We have commenced a combined human/murine 'reverse
genetic' program aiming to clone and characterize the gene(s) mutated in
GCPS/Xt. Our human studies include the isolation of clones from a chromosome
mediated gene transfer cell line (gift of Julia Dorin and David Porteous,
Edinburgh) containing approximately 10 megabases of human chromosome 7p. Our
murine studies are focused on YAC cloning in the vicinity of the transgene
integration site of the insertionally mutagenised Add mutant (which is allelic
to Xt), in collaboration with Uli Rther, EMBL, Hans Lehrach, ICRF and David
Burke, Princeton.
Mineral and Endocrine Disorders (MED) Group (Raj THAKKER and colleagues)
We are investigating the molecular basis of important metabolic and
endocrine disorders which affect calcium and phosphate homeostasis. The
disorders of calcium homeostasis that are being studied are Multiple Endocrine
Neoplasia Type 1 (MEN1) and hypoparathyroidism, and that of phosphate
homeostasis is X-linked hypophosphataemic rickets (HYP). We have previously
undertaken family linkage studies and have localised the MEN1 gene to
chromosome 11q13, the X-linked recessive hypoparathyroidism gene to Xq26-q27
and HYP to Xp22.31-p21.3. This localisation of each of the disease loci
represents the first step towards defining the genetic abnormality and in
subsequently characterising the disease gene product ie. the protein. Since
our initial mapping of these disease loci, we have extended our studies and
have undertaken further investigations to identify the genes causing these
disorders. Our efforts have been mainly directed towards identifying the
mutant gene causing MEN1, and in establishing chromosome 11 linking libraries.
Multiple Endocrine Neoplasia Type 1 (MEN1)
Men1 is characterised by the combined occurrence of tumours of the
parathyroid glands (causing hypercalcaemia), the pancreatic islet cells and the
anterior pituitary gland. The disease may arise sporadically or be inherited
as an autosomal dominant condition. The genetic abnormalities which cause
inherited disorders may involve two or more recessive mutations and these have
been investigated in MEN1 using the techniques of molecular biology. Our
studies have demonstrated that allelic deletions on chromosome 11 are involved
in the monoclonal development of parathyroid tumours, which are the commonest
feature of MEN1. In addition, our studies of three affected families
established linkage with the oncogene INT2.SS6 (peak LOD score = 3.30, q =
0.00). The MEN1 gene was thus mapped to the pericentomeric region of the long
arm of chromosome 11 (11q13).
In order to establish a more precise genetic map around the MEN1 locus,
we have obtained blood samples from 22 more families with MEN1 and have
collected data for a national MEN1 register. Our present collection of 25 MEN1
families represents the largest series in the world and provides a valuable
resource for further molecular genetic and endocrine studies of MEN1. We are
currently using 17 polymorphic DNA probes from 11q13 to define a precise
genetic map around MEN1. We are also pursuing deletion mapping studies in MEN1
tumours using these 17 polymorphic markers in order to define the smallest
region of loss within tumours. In addition a physical map of 11q13 is also
being established using pulsed field gel electrophoresis (PFGE). Further
studies are also being undertaken by using a linking library from chromosome
11.
Hypoparathyroidism
Hypoparathyroidism is an endocrine disorder in which hypocalcaemia and
hyperphosphataemia are the result of a deficiency in parathyroid hormone (PTH)
secretion. Idiopathic hypoparathyroidism has been reported to occur as an
X-linked recessive disorder in two multi-generation kindreds in Missouri, USA.
Affected individuals, who are males, suffer from infantile onset of epilepsy
and hypocalcaemia, which appears to be due to an isolated congenital defect of
parathyroid gland development; females are not affected and are
normo-calcaemic. We have established linkage between X-linked
hypoparathyroidism and the DXS98 (4D.8) locus (peak LOD score = 3.82, q =
0.05), and have mapped this disease locus to Xq26-q27. Multilocus analysis
indicated that the disease locus is proximal to DXS98 but distal to the F9
(factor IX) locus. These results open the way for elucidating the genetic
component involved in the embryological development of the parathyroid glands.
We are pursuing studies to define precise genetic and physical maps around the
X-linked hypoparathyroid locus. In addition, we have identified two families
in which parathyroidism is inherited as an autosomal recessive disorder and one
family in which there is an autosomal dominant inheritance. Investigations are
underway to identify the mutations causing these autosomal forms of
hypoparathyroidism.
X-linked hypophosphataemic rickets (HYP)
Hypophosphataemic (vitamin D resistant) rickets is the commonest form
of metabolic rickets and an X-linked dominant inheritance has been established.
Affected individuals have a renal tubular defect in phosphate transport and
bone deformities. We have previously performed linkage studies and have mapped
HYP to Xp22.31-p21.3 with the locus order Xpter-DXS43-HYP-DXS41-Xcen. More
recently the linkage relationships of the cloned sequences DXS197 and DXS207 in
relation to HYP have also been defined. Studies in man have been limited by
the number of families available and the lack of highly polymorphic markers in
this region. In order to overcome this we have pursued investigations using
the murine homologous model hypophosphataemia (hyp). An interspecific back
cross between Mus.spretus (wild type) and Mus.domesticus which is segregating
for hyp and ta has been established in collaboration with Dr. S. Rastan
(Section of Comparative Biology, Clinical Research Centre). We are
investigating this interspecific back cross using murine DNA probes derived
from CpG rich island libraries, which have been constructed by Dr. N.
Brockdorff and Dr. S. Rastan (CRC, Harrow, Middlesex). Our aim is to define
genetic and physical maps around the murine hyp locus and to identify candidate
gene sequences. The characterisation of the murine hyp locus will enable
characterisation of the HYP locus in man. We are also pursuing studies of the
HYP locus in man by using a linking library from Xp.
Chromosome 11 and Xp linking libraries
Two genomic libraries comprising of clones containing CpG rich islands
have been successfully constructed using the rodent-human hybrid cell line
1W1LA4.9, which contains chromosome 11 and Xp. CpG rich islands are found at
the 5' (upstream) region of vertebrate genes and the use of clones containing
such regions enables the identification of potential candidate genes. The
genomic libraries were constructed using the rare-cutters Not I and Eag I and
the regional localisation of these Not I and Eag I clones is being established
by using a panel of somatic-cell hybrids containing fragments of human
chromosome 11 or Xp. These Not I and Eag I linking clones will facilitate our
genetic and physical mapping studies of MEN1 and HYP. In addition, these
linking libraries of chromosome 11 and Xp will prove a valuable resource to
other investigators who are pursuing disease loci on chromosome 11 and Xp.
These studies of multiple endocrine neoplasia type 1 (MEN1),
hypoparathyroidism and hypophosphataemic rickets (HYP) represent an integrated
programme of basic science research applied to important mineral and endocrine
disorders. Thus, in the investigation of MEN1 we are defining the basis for
endocrine tumour development while in the study of X-linked hypoparathyroidism
we are identifying the genetic component regulating the embryological
development of the parathyroids, and in our investigations of HYP we aim to
characterise a membrane transport protein for phosphate. These studies will
further elucidate the physiological roles of these genes and their encoded
proteins.
Clinical Genetics (Dysmorphology) Research Group (Robin Winter)
There are two main aspects of the research of the dysmorphology
research group. The first is the use of computers for the diagnosis and
classification of rare genetic conditions by creating and maintaining databases
and appropriate computer software. The second is the genetic mapping of major
genes predisposing to isolated malformations and malformation syndromes.
The London Dysmorphology Database (LDDB) is a computer data-base of
about 2,000 non-chromosomal, multiple congenital anomaly syndromes that can be
used both as an aid to diagnosis for the clinician and as a reference source.
It is available commercially through Oxford University Press. This is a joint
project with Dr. Michael Baraitser (Institute of Child Health). A database of
mouse malformation syndromes that can be searched by combination of physical
abnormalities has also been prepared.
Contributions to the human gene map include the mapping of Greig
Cephalopolysyndactyly (GCPS) to 7p13 (in collaboration with Bob Williamson,
London), the hypothesis that GCPS might be homologous to the mouse Xt - Extra
toes gene, and mapping of complicated X-linked spastic paraplegia and mental
retardation (MASA syndrome) to Xq28 (in collaboration with Kay Davies, Oxford).
Current mapping work focuses on autosomal dominant craniosynostosis syndromes
ad major genes for cleft lip and palate.
Human Genome Mapping Project (Edward Tuddenham, Haemostasis Research Group,
Clinical Research Centre)
Activities relevant to Human Genome Mapping and to Mouse Genome Mapping
1. Human Genome
In the course of improving methods for linkage analysis in haemophilia
A we have identified a series of tandem repeat segments within the introns of
the factor VIII gene. One of these has been characterised and proved to by
highly variable and extremely useful in linkage analysis for kindreds
segregating haemophilia A. We are also sequencing the exon flanking sequences
in order to construct primers for rapid screening by means of PCR/chemical
cleavage mismatch for mutations in haemophilia A. In a parallel project we are
studying mutations in the factor VII gene of patients with factor VII
deficiency. In the course of these studies we have identified a VNTR within
the gene located therefore in the 13q34 region which may be useful for other
mapping studies.
Hereditary Haemorrhagic Telangiectasia is an autosomal dominant
condition with as yet no established linkage. In collaboration with Dr.
Michael Hughes at RPMS, we are preparing to collect samples from several large
kindreds and to begin screening for linkage to highly informative markers
throughout the genome. There are a few candidate genes that will be screened
initially for linkage.
2. Projects relevant to mouse genome project
In order to derive mouse models of haemophilia we have cloned the mouse
factor IX gene in a series of overlapping cosmids. We have also partly
(possibly completely) cloned the mouse factor VIII locus in lambda phage
obtained from a library specifically constructed for the purpose. We also have
YAC clones that hybridise to a mouse specific factor VIII probe and which could
contain the entire mouse factor VIII locus.
General comment
An overall objective of the group is to advance knowledge of the
structure and function of the coagulation factor proteins using variant
proteins occurring spontaneously in haemophilia or thrombophilia as a tool in
molecular analysis. We are also interested in the regulation of coagulation
factor genes, in particular, tissue factor and factor VIII. Our work on mouse
clotting factor genes was initiated in order to construct by means of
homologous recombination mouse models of haemophilia. This interest would
extend to cloning other mouse coagulation factor genes in order to make models
of human thrombophilia. We are sharing information and will share samples for
the HHT mapping project with Dr. John Burns group in the Division of Human
Genetics, University of Newcastle upon Tyne.
Molecular Genetics of the Mouse X-chromosome (Drs. Rastan, Brockdorff and Kay
- Section of Comparative Biology, CRC)
Our research on the molecular genetics of the mouse X chromosome is
directed at (1) understanding the mechanism of X-chromosome inactivation, (2)
the identification of genes associated with mouse X-linked mutations and, in
many cases, with X-linked genetic disease in man and (3) the generation of new
mouse models of human X-linked disease.
To this end we have produced CpG-rich island linking libraries (NotI
and EagI linking libraries) from the mouse X chromosome and isolated over 250
independent X-chromosome specific linking clones. 81 linking clones have been
sublocalized to four regions of the mouse X-chromosome, using a panel of
translocation carrying somatic cell hybrids which divide the X-chromosome into
four regions.
We have concentrated our efforts on the central region of the mouse
X-chromosome, defined by the translocation breakpoints (T(X;16)16H and
T(X;2)14R1, which contains not only the X-inactivation centre, but also, the
tabby (Ta), mottled (Mo), broadheaded (Bhd) and sex-linked fidgit (Slf) loci.
Seventeen NotI and EagI linking clones localized to this 11cM central region of
the mouse X-chromosome have been mapped and ordered with respect to each other,
existing DNA markers and genic loci, using interspecific backcross pedigree
analysis. This region now contains on average one marker per 1,000Kb, which is
well within the density needed to initiate physical mapping by Pulsed Field Gel
Electrophoresis. In collaboration with Dr. Steve Brown's group at St. Mary's
Hospital Medical School, we have initiated physical mapping of this region,
with the aim of eventually producing a contiguous physical map.
One linking clone in the central region, DXCrc171, detects a
muscle-specific transcript, and a number of cDNAs have been isolated from a
muscle-specific cDNA library. As EM171 maps close to the Slf locus, it may be
a candidate gene for this locus.
Similarly, a further linking clone, DXCrc169, has been used to isolate
a highly evolutionary conserved sequence which co-segregates with Ta in our
interspecific backcross pedigree analysis. Ta is the mouse homologue of the
human disease gene hypohidrotic ectodermal dysplasia (XHED). We are currently
analysing this conserved sequence as a possible candidate gene for the Ta
locus.
Transplantation Biology Section, Clinical Research Centre
Mapping and cloning genes encoding ligands selecting the T cell repertoire
(Drs. E. Simpson, K. Tomonari, P.J. Dyson, D. Scott and D. Altmann)
Recent work published from our own and other laboratories has shown
that selection of the T cell repertoire in the thymus, and hence the potential
for reactivity of peripheral T cells towards self and foreign molecules, is
governed by self-ligands associated with self major histocompatibility complex
(MHC, H-2 in mouse, HLA in man ) class I and class II molecules. The
expression of many of these self-ligands is polymorphic amongst inbred mouse
strains. We are using the newly developed method of chromosome mapping by
polymorphic microsatellites in backcross mice phenotyped for T cell receptor
(TCR) expression to map the genes encoding the selecting ligands. Chromosomal
mapping is being followed by physical mapping using YACs when we have
identified tight linkage (one example is currently being tested). Candidate
genes will be assessed in transfectants screened for expression by T cell
clones specific for the ligands. An alternative strategy for cloning genes
encoding these and other ligands recognised by T cells (eg. autoantigens), by
modifying the Seed shuttle vector system, is also being developed (MRC core
funding with an associated Cancer Research Campaign grant).
T cell repertoire selection is also affected by expression of MHC
genes, which are highly polymorphic in mouse and man. Certain MHC alleles in
man are associated with predisposition to autoimmune disease (Type I diabetes,
MS, RA). We are making mice transgenic for expression of particular human MHC
class II genes to model human autoimmune disease (MRC core funding associated
with an Arthritis and Rheumatism Council grant).
The Y chromosome has relatively few functional genes, among them is
that encoding the male specific minor histocompatibility antigen, H-Y. Our
previous work, in collaboration with Drs. Anne McLaren, David Page, Els Goulmy
and Malcolm Ferguson-Smith, separated the H-Y gene both in mouse and man from
the testis-determining gene and mapped Hya on the short arm of the mouse Y
chromosome, linked to Tdy, and HYA on the long arm of the human Y, distant from
TDF on the short arm and close to the pseudoautosomal region. We are
continuing deletion mapping studies in both species to obtain a moire accurate
position of Hya and HYA.
Biochemical Genetics Research Group (Chris Danpure and Ed Purdue)
Normal human alanine:glyoxylate aminotransferase (AGT) cDNA has been
cloned and sequenced (in collaboration with Yoshikazu Takada, Scripps Clinic)
and a complete genomic clone has been restriction mapped and sequenced,
demonstrating the presence of 11 exons covering about 10 kb. In situ
hybridization (in collaboration with Sue Povey, MRC Human Biochemical Genetics
Unit) and PCR analysis of human/rodent hybrid cell lines have indicated a
chromosomal localization of 2q36-37. Three point mutations linked with the
peroxisome-to-mitochondrion AGT targeting defect, found in one third of all
patients with the autosomal recessive disease primary hyperoxaluria type 1,
have been identified. In vitro mutagenesis/transfection/in vitro
translation-import studies are currently under way to determine the exact
contribution of each mutation to the acquisition and loss of functional
mitochondrial and peroxisomal targeting sequences respectively. The molecular
evolutionary basis of the species-dependent targeting of AGT is currently being
investigated by comparison of AGT gene sequences in different mammals in
relation to their different intracellular localizations of AGT.
Section of Molecular Rheumatology (Dr. Patricia Woo and colleagues)
The molecular genetics of serum amyloid A
The main interest of this group centres around the acute phase protein
serum amyloid A. During an acute inflammatory response serum amyloid A levels
can rise to over 1,000 fold within 24 hours of initiating the event. There is
a gene family for SAA and four genetic loci have been mapped in a cluster
within a Not 1 band of approximately 350kb on chromosome 11. Useful
restriction polymorphic sites have been defined for gene mapping of related
genes on this chromosome.
SAA genes are regulated by the inflammatory cytokines Interleukin-1,
Interleukin-6 and TNFa. So far our studies have been focused on the
transcriptional regulation of these genes and transcription factors that
mediate IL1 and IL6 responses are being characterised. Collaboration with J.
Saklatvala (Strangeways Laboratory, Cambridge) to study the intracellular
signalling pathway in more detail is in progress.
Serum amyloid A protein also is the precursor protein for amyloid
fibrils in the potentially fatal disease amyloidosis that complicates chronic
inflammation like juvenile or rheumatoid arthritis. In the past it has been
difficult to purify large quantities of pure proteins for structure and
function studies. The cloning of these genes allow us to study this by using
recombinant proteins produced by high expression vectors in a mammalian system.
The pathogenesis of amyloidosis could also be studied using these recombinant
proteins. The use of transgenic technology is planned to study the biological
significance of these SAA proteins.
HLA associations with disease
One subgroup of juvenile chronic arthritis has been shown to have
strong HLA associations of DR5, DR8 and DPw2 in the past. A collaborative
study is in progress with the RPMS (A. So) on the HLA associations with
juvenile arthritis. Sequences of DRb and DPb chains are being compared using
DNA amplification by PCR and oligonucleotide hybridization techniques.
ii) IMPERIAL CANCER RESEARCH FUND
a) Director's Laboratory (Sir Walter Bodmer)
New approaches to the prevention and treatment of colorectal cancer,
overall the second most frequent cancer in Britain, will come from an improved
understanding of the fundamental genetics and biology of normal and abnormal
colorectal epithelium. The laboratory's effort is devoted to genetic and cell
biological studies in this area.
Following the mapping of the gene for adenomatous polyposis coli (APC)
to chromosome 5q21, various approaches are being used to find the gene itself,
in collaboration with the Molecular Analysis of Mammalian Mutation and Somatic
Cell Genetics laboratories. Highly informative flanking markers are now
available for genetic counselling and various approaches are being used to find
new clones in the neighbourhood of the APC gene region. Now that site-directed
integration of selectable genes near to the APC locus has been achieved, the
derived clones can be used for functional assays of tumour suppression by the
APC gene.
Mutations in the p53 gene in colorectal carcinoma derived cell lines
have now been detected using DNA sequencing and chemical mismatch cleavage
analysis. These changes correlate with increased expression of the p53 protein
as detected by antibody assays. Reagents are being produced to carry out a
functional analysis of the DCC gene as well as for long range physical mapping
of chromosome 18. Genetic studies are also being undertaken on non-polyposis
inherited colorectal cancer syndromes.
Using cDNA expression cloning in mammalian cells, a cDNA clone for the
AUA1 antigen has been isolated and is being used for functional analysis of the
AUA1 antigen, in particular in connection with binding to extracellular matrix
components. The role of carcinoembryonic antigen (CEA) in helping to mediate
the attachment of the colorectal carcinoma-derived cell line SW1222 to collagen
I is being studied further by the isolation of additional CEA related clones
for functional analysis, the insertion of CEA by transfection into
non-expressing cell lines and by further studies on the effects of monoclonal
antibodies on glandular differentiation of responsive colorectal carcinoma cell
lines. In addition expression cloning is being used to characterise the nature
of the extracellular receptor expressed by the cell line SW122.
The frequency of ras oncogene mutations has been shown to be
significantly lower in a series of African colorectal carcinomas than it is in
caucasoid derived tumours, suggesting differences in the aetiology of the
carcinomas in these populations.
b) Laboratory of Human Molecular Genetics (Dr. Peter Goodfellow)
The laboratory is interested in two main areas of research. First, the
developmental genetics of mammals using sex determination as a model. Recent
studies have included the cloning of the pseudoautosomal region boundary and of
SRY, a new candidate for the Y chromosome gene responsible for inducing testis
formation. The second area of interest is the development of new strategies
for controlled fragmentation of mammalian chromosomes.
c) Human Immunogenetics Laboratory (Dr. John Trowsdale)
The Human Immunogenetics Laboratory is interested in: 1) The
organisation and functions of genes in the HLA region on the short arm of human
chromosome 6. 2) Chromosome 6 in relation to t complex genes and to cancer.
3) Human zinc finger gene families.
The HLA Region. The HLA complex encompasses over 50 genes on a stretch of DNA
of about 4mbp. This is over 1/1000th of the human genome, or about the size of
the E. coli genome. The region is associated with a large number of diseases,
mostly of the autoimmune type. Our main efforts have been to isolate the class
II genes, a process which is not yet complete, and to study their functions by
transfection and expression in various cell types. We have now cloned the
whole of the class II region in YACs, in order to facilitate further gene
hunting and eventual sequencing of the whole MHC. Recent work has uncovered
several novel genes in the class II regions and we are investigating their
potential role in antigen presentation as well as their association with
diseases.
Chromosome 6. We have prepared irradiation hybrids containing fragments of
chromosome 6 in a hamster background as a mapping tool. We have mapped some of
the human equivalents of mouse t complex genes, such as TCP-1 to the long arm
of chromosome 6. In addition, ovarian tumour/normal matched DNA samples have
been prepared to look for allele loss. There are reports of the involvement of
6q in ovarian and colon cancer as well as melanoma and other tumours.
Zinc finger genes. Our interests in this area have evolved from some initial
studies looking for transcription regulators. We have described some extremely
large families of multi-finger genes in man and mouse and are now attempting to
isolate the specific DNA sequences they bind to.
d) Genome Analysis Laboratory (Dr. Hans Lehrach)
A major part of our work is concerned with development and application
of new approaches to genome analysis, including the development of libraries as
high density molecular mapping techniques (cosmid reference libraries of
different human chromosomes, D. Melanogaster and S. Pombe, YAC libraries from
man and mouse), the development and application of efficient
hybridisation-fingerprinting techniques for the construction of ordered
libraries of these organisms, and the development of short oligonucleotide
hybridisation into an efficient sequence-fingerprinting and sequencing
technique, applied e.g. to the characterisation of cDNA clone libraries. This
work is complemented by the analysis of specific human (Huntington's disease,
fragile X) and mouse genes (developmental mutations in the t complex,
disorganised, steel), with a major emphasis on the use of YAC clones in
transgenics to test for complementation of the relevant mutations in mouse, or
to create appropriate animal models for human diseases.
e) Human Cytogenetics Laboratory (Dr. Denise Sheer)
We are interested in the analysis of consistent chromosome aberrations
in human tumours. In the past few years, we have focussed mainly on childhood
solid tumours and are now attempting to clone and identify the genes located at
the translocation breakpoints in the t(11;22)(q24;q12) in Ewing's sarcomas and
peripheral neuroepitheliomas. Several strategies are being used to this end,
including the construction of NotI linking libraries, the isolation of YACs,
and Alu-PCR cloning. Relevant probes are being mapped using a panel of
interspecific somatic cell hybrids containing various fragments of chromosomes
11 and 22, and also using pulsed field electrophoresis.
Our other major interest is the development of in situ hybridisation
techniques for high resolution gene mapping and ordering. The simplest method
involves the labelling of probes with biotin, hybridising the probes to
chromosomes, and detecting them with avidin conjugated to fluorescein. The
simultaneous use of two labels, such as biotin and digoxygenin, detected with
different fluorochromes enables two or more probes to be ordered. We are also
setting up this technique for the identification of specific chromosome
rearrangements in solid tumours as a diagnostic acid. As it is often difficult
to obtain good chromosome preparations from these tumours, the presence of
particular translocations, for example, can be determined in interphase cells
after hybridisation with probes mapping on either side of the translocation
breakpoints.
f) Molecular Analysis of Mammalian Mutation Laboratory (Dr. A-M. Frischauf)
We are searching for several genes involved in diseases. One project
concerns the identification of the gene for polycystic kidney disease. The
region between flanking genetic markers has been completely cloned (in
collaboration with S. Reeders, Yale) and we are applying various procedures
that are generally used to search for genes in cloned genomic DNA. In
particular we would like to concentrate on the comparison between cloned human
and mouse DNAs from a relatively small homologous region. It may be necessary
to screen the smallest possible region in great detail since there appears to
be a large number of genes and high resolution long range restriction mapping
has given no indication of deletions or rearrangements in the region.
In collaboration with E. Solomon and W.F. Bodmer we are isolating new
markers from the region of the APC gene and expanding the region around the
markers by screening A. Monaco's YAC library. The markers are being used in
the construction of a long range restriction map that will define the
breakpoints in some patients with cytologically visible deletions. Conserved
sequences are used in the search for the gene.
iii) CHARING CROSS HOSPITAL MEDICAL SCHOOL (Keith Johnson)
We are a group of eight engaged on mapping loci on human chromosome 19.
We collaborate with the group of Steve Brown at St. Mary's on the comparative
mapping of mouse chr 7 and human chr 19q. Our major interest is the myotonic
dystrophy locus, for which we have generated detailed genetic and physical
mapping data. As a result of this work we have extensive collections of probes
for chromosome 19 as well as grids of cosmid clones for the entire chromosome
and a subset specific to 19q13.2-13.3. Additionally we have interests in the
malignant hyperthermia locus at 19q13.1-13.2 and we are actively mapping around
the c-MEL locus on 19p13.1. We have constructed several PFGE maps of these
different regions, comprising a total of 4-5Mb or about 10% of the chromosome
length. We are currently characterising YAC clones of the myotonic and MEL
regions looking for new genes within them. To date we have identified three
new gene families from these resources and we are currently characterising
these.
iv) ST. BARTHOLOMEW's HOSPITAL
We are currently studying the candidate genes underlying the inherited
basis of non-insulin-dependent diabetes and premature coronary atherosclerosis.
The project involves identifying possible loci using primarily a population
genetics approach and then amplifying promoter sequences and critical exons for
DNA sequencing, to compare cases against controls. The major genes that we are
studying for non-insulin-dependent-diabetes are the insulin receptor on
chromosome 19 P13; glucose transporter 1 on chromosome 1 P35, glucose
transporter II, chromosome 3P26; and glucose transporter IV on chromosome 17
P11.
With regard to the candidate genes for premature atherosclerosis, we
are currently studying the apo-AI/CIII/AIV gene cluster on chromosome 11 and
the lipoprotein lipase gene on chromosome 8P22 as well as the hepatic lipase
gene. Possible etiological mutations will hopefully be identified, using this
approach.
v) ST. MARY'S HOSPITAL MEDICAL SCHOOL
a) Mouse Molecular Genetics Group (Dr. Steve Brown)
Mouse X chromosome
A major project is underway, funded by the MRC and in collaboration
with Drs. S. Rastan and N. Brockdorff at the Clinical Research Centre, to
map and characterise the X-inactivation centre. A large number of microclones,
linking clones and other genic probes have been genetically ordered in the
region of the X-inactivation centre. Several clusters of probes have been
physically-linked with the ultimate aim of constructing a physical map of the
X-inactivation region with a YAC contig which will provide access to the
underlying sequences responsible for the initiation of X-inactivation (Jacquie
Keer and Renata Hamvas).
We are also investigating the long-range structure of a repeat sequence
island on the mouse X chromosome. The island consists of 50 copies of long
complex repeat unit localised to the A3 dark-band of the mouse X chromosome.
The repeat sequence island possesses two features that have been suggested as
diagnostic features of mammalian Giemsa-positive bands. First, the repeat
sequence island encompasses a 1-megabase region devoid of CpG islands; second,
it features a high concentration of L1 long interspersed repeat sequences. We
are presently recovering YACs from the island in both lab mice and wild mice to
investigate further the long-range organisation and evolution of this
chromosomal domain (Jamil Nasir and Patrick Mileham).
Mouse chromosome 7
We have undertaken the comparative mapping of the proximal region of
mouse chromosome 7 and established a conserved linkage group to human
chromosome 19q - the location of the myotonic dystrophy (DM) locus. The
comparative mapping has identified a small genetic region (1cM) on mouse
chromosome 7 that is likely to contain the mouse homologue to the DM gene.
Supported by the MRC, at present work on this project is concentrating on the
establishment of a YAC contig covering the region of the mouse DM gene. In
order to assist this work and to supplement the available mouse YAC libraries,
we are presently constructing our own mouse partial RI YAC library (Francois
Chartier and Julian Cavanna).
In addition to work on the proximal region of mouse chromosome 7, we
also have underway a mapping project, funded by the MRC, to isolate and
characterise the mouse shaker-1 locus, a deaf mutation (in collaboration with
Dr. K. Steel, MRC Institute of Hearing Research, Nottingham). Extensive
genetic analysis of this locus through large backcrosses has allowed us to
identify a DNA marker within several hundred kilobases of the gene. A YAC
clone to this marker is being sought (Kathryn Brown and Maxine Sutcliffe).
Mouse chromosome 16
Utilising interspecific backcrosses a genetic map spanning the whole of
mouse chromosome 16 has been constructed. New probes to mouse chromosome 16
are being generated using inter-repeat PCR. An oligo from the 3' end of the
mouse L1 repeat element has been used to specifically amplify mouse sequences
from Chinese hamster-mouse hybrids containing only mouse chromosome 16. A
number of the PCR products have now been mapped on mouse chromosome 16 in
particular in the region syntenic with human chromosome 21 (Nick Irving).
b) N.W. Thames Regional Health Authority DNA Laboratory
(Carolyn Williams)
The main aspect of our work is cystic fibrosis carrier detection and
prenatal diagnosis. We are developing multiplex systems for the detection of
the more rare mutations for CF on the basis of allele specific primers. There
has been a pilot study for the preconception detection of CF carriers in the
community running now for three months. Finally, we are currently establishing
the reliability of PCR for the detection of single locus sequences within a
single cell with a view to investigating allele segregation distortion.
c) Alzheimer's disease and mapping chromosome 21
(Alison Goate and John Hardy)
Alzheimer's disease is a very common neurodegenerative disorder
affecting over half a million people in this country alone. At least in some
cases the disease appears to be familial. Several large pedigrees have been
described in which the disease onset is below age 65 yrs and appears to show an
autosomal dominant mode of inheritance. We and others have reported linkage
between Alzheimer's disease and DNA markers on the long arm of chromosome 21 in
several pedigrees with the early onset form of the disease. The markers most
closely linked to the disease gene are in the proximal region of the long arm
(D21S13, D21S16, D21S1/S11) and not in the "obligate Down's region". Recent
work in collaboration with Dr. Peter St. George-Hyslop has demonstrated that
Alzheimer's disease is genetically heterogeneous and that late onset familial
cases did not show linkage to chromosome 21 markers.
We have used pulse-field gel electrophoresis to make a physical map of
the proximal region of the long arm of chromosome 21. We are currently trying
to isolate markers on the short arm of chromosome 21 to try to determine
flanking markers for the AD gene and to extend our physical map of the
chromosome onto the short arm. We are using several methods to isolate new
polymorphic markers including screening clones for dinucleotide repeat
sequences and Alu PCR in rodent/human hybrids to isolate new probes mapping to
specific regions of the chromosome.
d) Hereditary ataxia (Dr. Sue Chamberlain)
The research group at St. Mary's has been established for the past
five years working primarily on Friedrich's ataxia, a recessively inherited
neurodegenerative disorder affecting the sensory nervous system with onset in
childhood. In addition to confinement to a wheelchair, cardiomyopathy is also
a primary feature of the disorder. Understanding the molecular basis of this
disease will therefore provide insight into both the cardio- and
neuropathologies, the mechanism of neuronal degeneration in general and should
result in better management and eventually, therapy. Progress to date includes
the assignment of the disease locus to chromosome 9q13-21.1 and the further
definition of its precise location to a physical interval no greater than 1Mb.
The cerebellar ataxias are clinically a poorly defined group of related
disorders. In the majority of cases, the disease occurs sporadically or may
have a familial element. We have recently initiated a project to investigate
the molecular basis of one type of cerebellar ataxia, dominantly inherited
olivo-ponto-cerebellar atrophy (OPCA) in a large Cuban founder population.
With more than 1000 affected individuals homogeneous for a single mutation
available for analysis it should be possible to precisely map the disease locus
and approach the isolation of the defective gene itself. The clinical
phenotype in these patients is indistinguishable from that described in
families where the disease locus (SCA1) has been mapped to chromosome 6p.
Interestingly, the Cuban disease locus has been excluded from this region
providing conclusive evidence of genetic heterogeneity. A genome search is
currently underway.
e) Chromosome 21q22 (Drs. Peter Scambler and Elizabeth Fisher)
A Down's syndrome 'obligate' or 'critical' region has been proposed to
map to 21q22. We are creating embryo carcinoma cell hybrids containing 21q22
sequences using chromosome mediated gene transfer. Hybrids are currently being
characterised with respect to human DNA content and potential for
differentiation. Selected cell lines will be used to clone human expressed
sequences from 21q22 which are expressed in particular embryonal cell types.
Clones obtained will be inserted into the physical and genetic maps of the
region.
f) Chromosome 22q11 (Dr. Peter Scambler)
22q11 is a remarkable region of the genome in that it is the site of
numerous nonrandom constitutional chromosomal rearrangements; the supernumary
der(22)t(11;22) (q23;q11) is the most common non-Robertsonian constitutional
rearrangements in humans. 22q11 aberrations are seen in DiGeorge syndrome
(DGS) and cateye syndrome (CES); acquired rearrangements have been reported in
seven different tumours, the best known being the Philadelphia chromosome. In
addition, the region harbours sequences which appear to have been duplicated
during evolution, but which are separated by at least 1Mb (eg. bcr-like and
gamma-glutamyl transferase-like sequences). We have begun the physical mapping
of 22q11 using naturally occurring deletions and translocations seen in DGS
patients, pulse-field gel electrophoresis and YAC-walking.
g) Mapping interests (Dr. Jane Hewitt)
The human homeobox-containing gene HOX7 (the human homologue of the
Drosophila msh gene) has been localised to chromosome 4p16.1. This maps the
gene close to a human mid-line fusion syndrome, Wolf-Hirschorn Syndrome.
Unlike most other vertebrate homeobox genes, HOX7 is not part of a
tightly-linked Hos gene cluster, although it does appear to be part of a
separate homeobox gene family. I am constructing a long-range physical map of
the HOX7 locus and investigating the other members of the HOX7 family.
vi) INSTITUTE OF CHILD HEALTH (Dr. Sue Malcolm)
The Mothercare Department of Paediatric Genetics at the Institute of
Child Health mainly concentrates on gene mapping projects with future clinical
significance and unusual genetic inheritance. X-chromosome mapping studies and
moves towards cloning the disease gene are being carried out on X-linked
immunodeficiencies (Dr. Christine Kinnon) and X-linked deafness (Marcus
Pembrey). Linkage studies on Hereditary motor and sensory neuropathy type I or
Charcot Marie Tooth disease (Sue Malcolm with Anita Harding of the Institute of
Neurology) are part of the MDAs international consortium. The study of
Angelman syndrome (Marcus Pembrey and Sue Malcolm) has led to an appreciation
of parental effects or genomic imprinting through the finding of only
maternally derived deletions and uniparental paternal disomy. The genetic
contribution towards clefting is being studied with Robin Winter (CRC) and
there is an emphasis on the speedy transfer of research findings into clinical
practice.
vii) MOUNT VERNON HOSPITAL (Dr. Janet Arrand)
a) Dr. Janet Arrand (plus 1 research officer and one student, supported by the
CRC). Cloning and characterising the hamster and human genes which complement
the human genetic DNA repair defect in xeroderma pigmentosum (XP)D.
Identifying the mutations in XPD and the related genetic skin disorder,
Trichothiodystrophy. Physical mapping of the chromosomal region which contains
these genes. Isolation of XP proteins using antisera raised against peptides
expressed from the cloned human XPD gene sequences.
The development of predictive assays for radio- and UV-sensitivity
using cloned DNA repair genes.
b) Dr. Horst Lohrer (plus one research officer, supported by the CRC).
Correction of the Ataxia telangiectasia (AT) defect by fusion of AT cells with
hamster cells. Attempts to clone the correcting hamster sequence.
Damage-induced proteins and their role in mammalian DNA repair.
c) Drs. Janet Arrand and Mike Joiner (plus 3 staff and support requested from
the UKCCCR). Assessment and correlation of cell killing, carcinogenesis and
mutation (at loci on the X-chromosome) in human cells using low-dose ionising
radiation.
viii) THE GALTON LABORATORY
The Galton Laboratory has a long history of human gene mapping. The
first example of linkage between two human autosomal markers (nail patella
syndrome and the ABO blood group) was discovered here. Interestingly, this
linkage group was later assigned to 9q34, a region which has recently again
become a focus of attention in the laboratory with the discovery of a linkage
between tuberous sclerosis and ABO.
Current research includes:
Physical mapping studies on chromosome 1p (B. Carritt)
Using somatic cell hybrids, pulsed field gel electrophoresis and cosmid
contigs we are analysing that part of 1p which contains the Rhesus locus. We
aim to correlate gene structure and genome organisation with serological
haplotype at this locus.
The use of denaturing gradient gel electrophoresis (DGGE) for human gene
mapping (D. Hopkinson and P. Johnson)
We have been evaluating this technique using known mutations at the
human _1-antitrypsin locus and, using various combinations of 5' or 3' attached
GC clamps, have been able to display all the common polymorphisms. We are now
beginning to study uncharted DNA sequences in collaboration with many of the
projects below.
The mucin gene family (D. Swallow)
The extent, nature, stability and significance of the extensive
polymorphism at the gene loci which code for mucins (so far MUC1 to MUC3) are
being studied. We have isolated cDNA and genomic clones for MUC1 and we have
mapped each of these genes to different chromosomes (MUC1 1q21; MUC2 11p15.5;
MUC3 7q) using a combination of somatic cell hybrid, in situ hybridization and
linkage analysis.
Biochemical and genetical analysis of the hydrolases of the small intestine (D.
Swallow and Y. Edwards)
We have isolated cDNA clones for lactase and cDNA and genomic clones
for sucrase-isomaltase (SI). We have mapped SI to chromosome 3q25-26 and we
are searching for polymorphism at the SI and lactase loci for the purpose of
family analysis.
Assignments of new genes to chromosomal regions by somatic cell genetics (S.
Povey)
There is a continual program of assignment of newly cloned genes to
chromosomal regions using somatic cell genetic techniques. In the past year
about 30 genes and polymorphic DNA fragments have been assigned to chromosomes
or to chromosomal subregions.
Family studies on Tuberous sclerosis. (S. Povey, M-W. Burley and J.
Attwood)
This dominant autosomal genetic disease is unusual in showing a very
high mutation rate and a wide variation in the degree to which it is expressed
ranging from the almost symptomless to severe affliction. The genetics is
complicated because two (possibly three) mutant loci with identical effects are
present in the population. The combined effects of locus heterogeneity and
difficulty of diagnosis coupled with a high mutation rate make genetic analysis
an interesting problem! It is being tackled in collaboration with many
laboratories both in the UK and in the USA using shared probes and families.
Conventional probes are being used but more highly polymorphic markers such as
poly CA repeats are being developed.
Irradiation fragment hybrids from chromosome 9q (J. Wolfe and S. Povey)
A panel of hybrids has been constructed which contain small fragments
of 9q in a hamster background. Suitable hybrids are being sought from which
9q34 probes may be isolated. Probes from one such hybrid are already being
screened for (CA)n and other highly polymorphic microsatellites. Polymorphic
probes will be used for TSC family studies. The panel of hybrids and probes
derived from them are available for other mapping studies on chromosome 9q.
Irradiation fragment hybrids from chromosome 11 (F. Benham and S. Povey)
Hybrid cell lines which retain unselected and selected fragments of
chromosome 11 are being constructed using high dose irradiation-fusion gene
transfer. Both hybrid series will be characterized according to fragment size,
number and origin by marker analysis and in situ hybridization. The unselected
hybrids will provide resources for 1) generating region specific probes from
throughout chromosome 11 and 2) ordering and mapping known probes using a
statistical approach. We plan to concentrate on developing markers for the
11q22-23 region with a view to improving the genetical and physical maps of
this region, to which the second tuberous sclerosis locus, TSC2, has been
localized. Both this study and the previous one make use of cytogenetic and in
situ fluorescence microscopy in collaboration with J. Delhanty.
Generation of probes from Xp22 (F. Benham)
Using a previously constructed panel of irradiation fragment hybrids,
probes are being isolated from the Xp22 region by a variety of methods
including alu primed PCR and construction of genomic libraries. These are
being used to improve the genetic and physical maps of the region.
Computer methods in gene mapping (J. Attwood)
We are interested in making genetic maps of entire human chromosomes,
as part of the CEPH collaboration, and in the localisation and precise mapping
of disease and other genes of interest. In collaboration with Prof. N.E.
Morton (CRC Genetic Epidemiology Unit, Southampton) we are investigating the
relative strengths of the currently available mapping packages, in particular
their ability to cope with errors in the data. One such method which we are
exploring with S. Povey uses a pairwise analysis of the mapping data. This
has a number of advantages when compared with the multipoint method. There is
no constraint on the number of loci, it uses lod scores (there is no need for
the primary data), it allows the pooling of data from many sources and it
allows for interference.
In collaboration with S. Bryant (ICRF, Clare Hall) we are also
developing ideas and software to enable family data to be more easily exchanged
between laboratories and be used as input for any of the available analysis
packages, converting reliably and intelligently between otherwise incompatible
data formats. An IBM PC-based family database management program,
incorporating many of these ideas, is currently under development and will
eventually be ported to run on Unix systems.
PCR markers for all the human chromosome arms (C. Abbott)
Pairs of primers have been developed (mostly from intronic or 3'
noncoding sequences) which are human specific and which enable the rapid
identification of the human chromosome arm content of rodent/human somatic cell
hybrids. This work is in press in Genomics.
Molecular genetic analysis of mouse chromosome 2 (C. Abbott)
This work has two primary aims. First, to improve the genetic map of
this chromosome and second, to isolate genes involved in neurological
development e.g. wasted (wst), anorexia (anx) and lethargic (lh). Proximal
mouse chromosome 2 (which shows genetic homology to human chromosome region
9q34) is being mapped using an interspecies backcross with Mus spretus. This
work is being carried out in collaboration with Dr. J. Peters (MRC
Radiobiology Unit, Harwell). In addition we are constructing a series of
mouse/hamster somatic cell hybrids containing various chromosome 2
translocations. These are being characterized by PCR using species specific
primers derived from chromosome 2 genes. A genomic library specific for the
chromosome is being constructed (from a hybrid cell line which contains only
mouse chromosome 2 in a hamster background) and it will be screened for
expressed sequences using brain cDNA depleted of repeated sequences by the
method of Hochgeschwender et al. (PNAS 86 8482).
A contig map of the human Y chromosome (J. Wolfe)
We have isolated 2,000 cosmid clones derived from the human component
of a mouse-human somatic cell hybrid which contains only the human Y. These
will shortly be joined by more clones derived from an independent Y only
hybrid. The clones are being fingerprinted by a variant of the method of
Coulson et al. (PNAS 83 7821). More than 500 clones have been fingerprinted
and 250 of the fingerprints have been digitized for computer analysis. This
step is now proceeding at the rate of about 200 clones per week. When all
2,000 clones have been fingerprinted, approximately 90% of the euchromatic
portion of the chromosome will have been cloned and approximately 60% of it
will be in contigs. We propose to continue fingerprinting until the rewards
(clones which extend or link contigs) cease to outweigh the effort involved.
We estimate that this will occur in about another 2,000 clones. The library is
available for screening as a gridded array both of colonies and of dot blots.
We would welcome anyone else's Y derived cosmids for fingerprinting.
ix) UNIVERSITY COLLEGE & MIDDLESEX SCHOOL OF MEDICINE
a) Cloning of human genetic disorders by use of short, conserved
oligonucleotides (Dr. Georg Melmer, Department of Psychiatry)
The mapping and eventual sequencing of the human genome depends upon
the power and efficiency of new techniques to be developed. We are developing
such techniques aiming to make long range mapping, identification of coding
sequences, and their searching simpler and considerably faster. We are using
short oligonucleotides (8-15 nucleotides) corresponding to conserved sequences
such as restriction enzyme sites, transcription factor binding sites or splice
sites. Several sets of oligonucleotides have been used so far.
These short oligonucleotides are designed to isolate sequences
corresponding to:
1) GC-rich sequences localised close to or within genes
2) Sequences associated with the binding of transcription factors
3) Sequences surrounding splice sites to detect expected exon-intron
boundaries.
This work is focused on chromosome 7 using a chromosome specific cosmid
library which is being screened with the three sets of oligonucleotides
described above. This library has already been screened with short tandem
repeat sequences for (CA) or (CT)n repeats and over 100 cosmids give positive
hybridisation. These will be of value in the generation of a genetic linkage
map of highly informative markers.
All cosmids have already been looked at with the splice site oligos and
the transcription factor binding site primers. It is expected to generate
three different "maps" side by side: the genetic map, the physical map, and the
distribution of coding sequences and at the end of the sequence itself.
b) Department of Medicine (Professor J.L.H. O'Riordan)
The major aim of this group is to study the genes controlling mineral
metabolism, ie. the maintenance of calcium and phosphorous homeostasis. The
control of the expression of the gene for parathyroid hormone (11pter-p15.4)
has been shown to be abnormal in parathyroid tumours. The gene causing
X-linked recessive hypoparathyroidism has been localised to Xq26-q27.
Mutations in the gene for the receptor for Vitamin D (chromosome 12) have been
shown to cause rickets due to end organ resistance. Studies of the gene
causing X-linked hypophosphataemic rickets are aimed at increasing the
understanding of phosphate handling, particularly in the kidney. The gene has
been localised to Xp22.31-p21.3 and flanking markers (DXS41 and DXS43)
identified. Further work is in progress to get closer to and to clone the
gene: that requires new markers in this region, and identification of deletions
in this part of the X-chromosome.
x) Royal Postgraduate Medical School, Hammersmith Hospital (Lucio Luzzatto)
(1) Molecular genetics of glucose 6-phosphate dehydrogenase (L. Luzzatto, P.
Mason et al.). We are investigating structural point mutations, promoter
structure and function, and the function of introns. We are also comparing the
structure of human, mouse and opussum G6PD, and we are in the process of
obtaining the malaria parasite G6PD gene.
(2) Studies on the BCR-ABL chimeric gene. (J. Goldman, J. Vaz de Melo et
al.). We are analyzing breakpoints in CML and ALL and investigating the
possibility of ABL mutations not involving PCR in "atypical" CML.
(3) The t(8;21) translocation which is highly associated with M2 AML. (F.
Calabi). We are investigating by various techniques, including microdissection
of metaphase chromosomes and the production of region specific libraries, the
breakpoint of this translocation.
(4) Studies on collagen genes (P. Mason, N. Turner). We are investigating
the gene encoding the antigen involved in the pathogenesis of the Goodpasture
syndrome.
xi) United Medical and Dental Schools of Guy's and St. Thomas's Hospitals
Molecular Genetics Laboratory (David Bentley and Francesco Giannelli's Group)
Identification of sequence variation for mapping, detailed locus
analysis and identification of disease related genes (Green, P.M., Harris, I.,
Montandon, A.J., Naylor, J., Roberts, R. and Saad, S.).
Our commitment to genome mapping and our interest in diseases of high
mutational heterogeneity (e.g. haemophilia B or coagulation factor IX
deficiency) has prompted us to develop methods for the rapid detection of DNA
sequence variations. We have thus developed a mismatch detection method
(amplification mismatch detection, or AMD) that can screen heteroduplexes of up
to 1.5kb for any kind of mismatch and so detect and locate any type of sequence
variation. This method has been used for the detection of DNA polymorphisms
(e.g. in the dystrophin gene) and the characterisation of mutations in
different genes (e.g. haemophilia A, haemophilia B, Tay-Sachs disease and
Cystic fibrosis).
Using AMD and direct sequencing of PCR products we have reduced the
time required fully to characterise mutations of the factor IX gene (34kb, 8
exons) to 4 person working days. Carrier and prenatal diagnosis based on the
direct detection of the gene defect have thus become feasible, increasing the
proportion of families that can be helped by precise genetic counselling from
50-60% to 100%. Furthermore, the characterisation of large populations of
patients and, hence, the full definition of the mutational profile of the
factor IX gene, has become feasible.
We have, therefore, conceived a strategy to optimise the genetic
counselling of haemophilia B while maximising the practical and scientific
advantages of diagnoses based on the direct detection of gene defects. This
requires the characterisation of the defect in every UK haemophilia B family
and the construction of a national database to store such information. This
can then be used for generation after generation to provide the relatives of
the index patients with carrier and prenatal diagnoses based on the detection
of the gene defect at 1/10 of the cost and in a fraction of the time currently
required. Up to now we have characterised more than 1/5 of the U.K.
population (total approx. 1,000 patients) and thus identified more than 60
residues essential to the structure and function of factor IX.
New technical advances, including the direct analysis of amplified
"leaky" mRNA from peripheral blood lymphocytes, are now being developed to
allow extension of the above strategy to diseases of high mutational
heterogeneity irrespective of the complexity of the gene and the prevalence of
the disease. For example, the entire dystrophin coding sequence has been
amplified in ten overlapped nested PCRs in Duchenne and Becker muscular
dystrophy patients and their relatives in order to detect the presence of
deletions or insertion at the mRNA level. This study forms the basis for
detection of point mutations by AMD analysis. These approaches should also be
valuable to identify specific disease-related genes among series of candidate
genes selected on the basis of mapping information.
Molecular mapping of the X chromosome (Coffey, A., Cole, C., Collins, J.,
Dunham, I., Flomen, R., Green, E., Hassock, S., Holland, J. and Todd, C.)
As a model system, yeast artificial chromosomes (YACs) spanning the
dystrophin gene have been isolated and overlapped in contigs using a
sequence-tagged site (STS) approach. individual STSs distributed throughout
the gene have been used to screen the YAC libraries of Burke and Olson (in
collaboration with E.D. Green, St. Louis) and Anand et al., by PCR. YACs
have been characterised by screening with cDNA probes. A rapid fingerprinting
method for overlapping YACs without prior knowledge of insert sequences has
been developed using the DMD YACs.
A panel of radiation fusion hybrids has been generated, which contains
regions of the X chromosome around the HPRT locus. The hybrids have been
characterised by hybridisation to single copy-probes. Alu PCR of the DNA from
one hybrid has been used to generate STSs and hybridisation probes for
isolation of YACs in Xq26. Optimisation of the Alu PCR conditions permits the
generation of fragments at intervals of 50-1,000kb in this region of the X
chromosome.
A library of clones derived from a microdissected region of the X
chromosome (Xq27.1-Xq28.1) is being used as a source of hybridisation probes;
to construct STSs for isolation of YACs; and for characterisation of
sub-microscopic deletions in patients suffering from Haemophilia and Hunter
syndrome.
Cosmid libraries from DNA of an individual with the karyotype 49, XXXXX
have been constructed, and deposited in ordered arrays. An automated gridding
procedure has been developed by construction of an inoculating tool and
associated software (soon to be released) to fit the Biomek 1000 robotic
workstation (Beckman). The cosmid clones have been verified by mapping
overlapping clones spanning a 200kb region. Work is in progress to build
larger contigs of overlapping clones and to identify landmarks within the map.
Automated sequences and genomic clone fingerprinting using fluorescent
labelling techniques is being evaluated using the Applied Biosystems AB1373
Automatic DNA Sequencer. Techniques are being developed to prepare samples
using either dye-labelled primers or dye-labelled terminators for detection of
overlaps by restriction fingerprinting (applied to YAC clones or cosmid
clones),detection of polymorphisms and mutations in genes using amplification
and mismatch detection (AMD) analysis.
Methods to screen YAC libraries both by hybridisation and by PCR
approaches have been optimised. The human YAC library of Burke and Olson has
been transferred from St. Louis, and DNA from pooled clones has been made for
PCR screening. Using the automated gridding facility developed for cosmids
(see above), the entire library (60,000 clones) can be deposited in ordered
arrays on 40 8x12cm filters for primary hybridisation screening. The library
is now established both here and in Oxford (with Dr. K. Davies). The library
and the screening technology is being transferred and will form part of the UK
Human Genome Resource Centre at Northwick Park, under the direction of Dr. R.
Sibson.
Ann Harris's Group (Boye, E., Chalkley, G., Coleman, L., Flinter, F., Foulkes,
A. and Vetrie, D.).
Our two main research interests are in the fields of cystic fibrosis
and Alport syndrome.
Cystic fibrosis. The CF work can be divided into three main areas. The first
and major one is the application of the cell systems that we have established
for pancreatic duct and male genital duct, to further understanding of the role
and mechanism of action of the CF gene product (CFTR). In particular we are
interested in regulation of expression of CFTR and the effect of expression
levels on cell phenotype. The second project is to analyse developmental
expression of the CF gene in Man, in order to throw light on the pathology of
the disease. The third project is to search for alternative mutations (other
than F508) in the CF gene.
Alport syndrome. Alport syndrome is an X-linked kidney disorder that is
characterised by chronic renal failure, high-tone sensorineural deafness and
specific eye defects in affected males. Carrier females show a wide range of
clinical severity. The gene maps to Xq21-22, an area of the chromosome that
has received comparatively little attention. Two projects are being
undertaken.
Firstly, we are constructing a long-range linkage map of this region of
the X chromosome by pulse-field gel electrophoresis, using markers that are
known to be closely linked to the Alport locus. YAC clones are also being
isolated from this region.
Secondly, it now seems likely that the a5 (IV) chain of basement
membrane collagen that maps to Xq22 is in fact the Alport gene product. We
have a large collection of DNAs from Alport syndrome families. This material
is now being analysed to establish the nature of the mutations in the a5(IV)
collagen chain that contributes to the disease.
S.E. THAMES REGIONAL DNA LABORATORY
Chris Mathew's Group (Abbs, S., Beards, F., Clarke, S., Dear, S., Differ,
A.-M., Holding, C., Lee, R., Silver, A. and Yau, M.).
We are using genetic linkage analysis to map the genes involved in
several human genetic disorders. Fanconi anaemia (FA) is a rare autosomal
recessive disorder associated with bone marrow failure and an increased
susceptibility to leukaemia. Candidate DNA repair genes are being tested, and
chromosomes not yet excluded for linkage to FA are being analysed
systematically.
We are also carrying out high resolution linkage analysis of
chromosomal regions of particular interest by means of the CEPH collaboration.
PCR markers at the 5' and 3' ends of the dystrophin gene have been analysed,
showing a 12% recombination rate across the 2.3Mb of this gene (Abbs et al.,
Genomics 7, 602-606; 1990). Further markers are being tested at this locus,
and multi-allelic PCR markers developed, in order to localize the intragenic
crossovers more precisely.
Nested PCR of sequences from single cells is being developed for
pre-implantation diagnosis and high resolution linkage analysis.
xii) Institute of Neurology (Professor Louis Lim & Dr. Christine Hall)
The group interests are concerned with the characterization of genes
either highly or specifically expressed in the human brain. These genes
include those for carboxypeptidase E, a putative neuropeptide processing
hormone and for n-chimaerin, a novel phorbol ester receptor (which is related
to PKC) containing a BCR-like domain (BCR is the product of the breakpoint
cluster region gene in chromosome 22). Both are single-copy genes of at least
75kb. Genomic organization is being studied with regard to regulatory
sequences responsible for brain- and regional-specific transcription as well as
to separate functional domains. Another interest is the characterization of
brain-expressed genes on chromosome 21. The group collaborates with the
Institute of Molecular and Cell Biology, Singapore.
xiii) London School of Hygiene and Tropical Medicine (Dr. Neil Stoker)
My interest is in the production of integrated genetic/physical maps of
bacterial chromosomes, in particular of Mycobacterium leprae and
M.tuberculosis, which cause leprosy and tuberculosis respectively. The main
relevance of the human genome mapping project to me is therefore
methodological. I am constructing ordered libraries using the fingerprinting
approach devised by Alan Coulson and John Sulston at the LMB, Cambridge, doing
the data entry and computer analysis using Peter Little's set up at Imperial
College. Restriction mapping and gene mapping on assembled parts of the map
are also underway. I hope that in the not-too-distant future this work will
lead to the sequencing of one of these genomes (probably M.tuberculosis), which
has a size of approximately 3Mb).
xiv) Imperial College of Science Technology and Medicine (Dr. Peter Little)
The short arm of human chromosome 11 is one of the most intensively
studied regions of the human genome. Over 350 DNA markers and genes have been
regionally localised, over 100 deletions have been identified and immortalised
in hybrid cell lines and a large body of work has been aimed at understanding
the involvement of this region in tumour formation and embryonic development.
It is an attractive candidate for any systematic mapping study.
For these general reasons, and also to provide a practical test-bed of
a human genome mapping project on a single lab scale of operations, we have
chosen to construct a cosmid clone map of human chromosome region 11p using
technology that was originally developed by John Sulston and Alan Coulson at
LMB Cambridge. We use mouse human hybrids containing 11p as source of the
chromosomal region (generated by Porteous and van Heyningen at the MRC human
genetics unit, Edinburgh) and isolate human cosmids, at random, by
hybridisation of radiolabelled total human DNA to cosmid libraries. These DNA
clones are cut with restriction enzymes to give a fragment "fingerprint" on an
acrylamide gel, the autoradiograph of which is digitized and analysed by a
sophisticated set of image analyses and data manipulation programs running on a
VAX station 3100. Cosmids that overlap with each other are identified by
having a similar or partially similar fingerprint. The project proceeds by
generating increasingly large regions of DNA contained in overlapping cosmid
sets, called "contigs". We currently have a database of 3700 cosmids and 500
contigs. This probably corresponds to 2.5 x 10^7 bp of DNA. We make extensive
use of a robot work station for growing clones, making DNA and general sample
handling, which we find reduces much of the inevitable tedium of reiterative
and stereotyped manipulations.
The 11p region corresponds to perhaps 40% of chromosome 11, which is
itself about 2.4% of the human genome: this means we are mapping about 40% of
1.44 x 10^8 bp or about 6 x 10^7 bp. We expect to have to analyse about 10,000
cosmids in total.
The equipment used to analyse and generate contig maps is available for
general use. We would point out that this approach should be a serious
consideration for anyone interested in generating ordered cosmid or phage
libraries from an individual YAC clone(s). This sort of small project (less
than 100 fingerprints) can be carried out within a few weeks of obtaining a
library. We would stress that if groups are interested in this approach, they
should approach us for advice before starting to collect data or clones. Our
experience is that simple advice is always needed at the start and this saves
much time later.
A major thrust of the genome project has been to centre on specific or
chromosomal regions, or on expressed genes. In a related project we have
started to work on Zn finger protein encoding genes (ZnFP). These genes,
remarkably, correspond to about 1% of the human genome and we have initiated a
systematic study of clusters of potential ZnFPs in both human and mouse
genomes, in collaboration with M. Mannens and J. Hoovers (Amsterdam). We
have identified clusters of ZnFPs in several provocative positions on the short
arm of chromosomes 3, 11, 19 and 20, and in similarly interesting regions of
19q, and the pericentric region of 21. ZnFPs have been implicated in
controlling a number of developmentally complex processes in D. melanogaster,
in tumorigenesis and identified as transcription factors involved directly in
controlling gene expressions makes them attractive candidate genes and we are
actively working to analyse the relationship of our ZnFPs with diseases and
conditions known to map to the appropriate regions.
Our work is generously supported by the MRC, by the Human Genome
Mapping Project directed program of the MRC and by the Cancer Research
Campaign.
8) THE EUROPEAN COLLABORATIVE INTERSPECIFIC BACKCROSS - A FACILITY FOR MAPPING
THE MOUSE GENOME (Dr. Stephen Brown, Dept. of Biochemistry and Molecular
Genetics, St. Mary's Hospital Medical School, London W2 1PG)
As indicated in G-NOME NEWS (no. 4), a policy document outlining the
role of Mouse Genome Mapping in the Human Genome Mapping Project has been
received by the Directed Programme Committee and its recommendations broadly
accepted. One of the proposals put forward by this report was to initiate a
facility for the genetic mapping of the mouse genome. A detailed proposal was
put to the Directed Programme Committee and funds are now available to put into
operation.
MOUSE GENOME MAPPING
Copies of the Report of last April's meeting on the role of mouse
genome mapping in the Human Genome Mapping Project are still available,
free-of-charge: telephone Joanne Grewcock at the Resource Centre (081-869 3805)
or send a fax (081-869 3807). The Report was accepted by the Directed
Programme Committee as a basis for policy in this area. It thus provides
useful guidance on what sort of grant applications are likely to find favour
with the DPC.
The aim of this facility will be to support the worldwide goal of a 1cM
genetic map of the mouse genome.
The mapping facility will make use of a large 1,000 animal
interspecific backcross between inbred lab mice and the wild species Mus
spretus. Use of interspecific backcrosses is now widespread taking advantage
of the high evolutionary divergence separating the two parental strains and the
ease with which restriction fragment length variants and other variants can be
found. 500 animals will be derived from backcrossing to lab mice and 500
animals derived from backcrossing to spretus. It is necessary to analyse 500
backcross progeny to have a 99% chance of separating markers that are 1cM
apart.
This genetic facility will operate from two centres:
1. The Resource Centre and Comparative Biology Section, CRC, London 2.
Institut Pasteur, Paris.
Both centres are presently engaged in generating backcross progeny and
both centres will participate in the mapping facility. Progress towards a
mapping facility is seen as a two-stage phased process:
Stage I:
a) generation of 1,000 backcross progeny set
b) isolation of DNAs; pooling of DNAs at the two centres
c) initial mapping analysis of DNAs to establish anchor loci
d) establishment of database structures
Stage II:
a) Full mapping facility: receipt of probes, STSs and provision of
mapping information to users
b) Fully operational mapping database and probe list.
Stage I involves the analysis of the entire cross with at least 60
readily usable DNA markers (preferably STSs) to provide anchor loci across the
genome. The choice of these loci has largely been determined by the work of
the mouse chromosome committees at the recent International Mouse Gene Mapping
Workshop (Annapolis, USA) that established a small set of at least five
reference loci for each chromosome. Such loci have already been widely used in
future mapping projects to allow the reference and anchoring of different maps
created in different laboratories. Most of these reference loci are STSs.
The initial genetic analysis identifies subpanels of mice with pools of
recombination events on individual chromosomes. Most subpanels will be devoted
to individual chromosome mapping; but subpanels can be created for rapid
chromosomal assignment. The subpanel system is flexible and panel size can be
increased to meet the needs of the mapper as ever more finer genetic intervals
are analysed at a particular chromosomal region. The initial typing of the
Backcross for Reference loci will depend not only on work at the two
participating centres, but also a number of British and French groups who with
substantial interests in Mouse Genome Mapping are prepared to supply probes and
participate in the establishment of the initial global, anchored STS map. It
is expected that Stage I will take at least one year to complete.
Stage II involves the operation of a full mapping service; DNA from
backcross progeny will not be generally available. Rather, probes will be
received and analysed at the two centres and mapping information transmitted to
the probe supplier. Stage II will also involve the implementation of on-line
access to the database supporting the cross.
A steering committee has been formed to oversee the operation of the
facility and includes representatives from the two mapping centres and the
Participating Groups.
Progress to date
The backcrosses at the Clinical Research Centre and the Institut
Pasteur are well advanced with close to 300 backcross progeny in total so far
recovered. At the Resource Centre, two staff have been appointed and have
begun the preparation of DNAs from backcross progeny produced on site.
Exchange of DNAs with the Institut Pasteur will begin shortly. At the
beginning of 1991, the first analysis of anchor loci will begin.
The Future
We look forward to the completion of the anchored, global STS map.
Following completion, we aim to issue necessary documentation to the genome
mapping community outlining mechanisms of access to the mapping facility. In
addition, the progress of this cross must take account of and interface with
similar projects underway in the States. Discussion is already underway on the
possibility of common database structures that would allow us to integrate
mapping information worldwide.
Further information may be obtained from:
Steve Brown Dept. of Biochemistry and Molecular Genetics St. Mary's Hospital
Medical School London W2 1PG
9) OLIGONUCLEOTIDE PRIMERS FOR PCR ANALYSIS OF MOUSE MICROSATELLITES
(Dr. John Todd, Nuffield Dept. of Surgery, John Radcliffe Hospital,
Headington, Oxford OX3 9DU)
All these primer sequences and conditions of use were contributed by
Dr. John Todd and colleagues and further information on their use may be
obtained from him at Nuffield Dept. of Surgery, John Radcliffe Hospital,
Headington, Oxford OX3 9DU; Tel.No: 0865-220145, FAX: 0865-68876). The HGMP
Resource Centre is aiming to synthesise all of these oligonucleotides in the
next few weeks and aliquots of these will be available to any registered users
under the standard conditions. These include the reporting back of details of
use of materials distributed from the Centre. Further details of the primer
availability and custom oligonucleotide synthesis can be obtained from Dr.
Gabrielle Fisher at the HGMP Resource Centre on tel.no. 081-869 3446.
A number of these primer sequences are unpublished and reference should
be made to the Newsletter and to John Todd for this privileged information.
Please see Appendix II for Mouse Chromosome Specific Microsatellites
table.
10) DIRECTED PROGRAMME AWARDED PROJECT GRANTS
Dr. Furzana Bayri
Medical Research Council
20 Park Crescent
London W1N 4AL
Project grants awarded by the HGMP Directed Programme Committee in July 1990:
i) Dr. K. Davies - "X chromosome Workshop"
ii) Dr. S.D.M. Brown - "A European collaborative interspecific backcross
facility for mapping the mouse genome"
iii) Drs. Y. Boyd, K.E. Davies and M.C. Hirst - "Comparative mapping of
mouse and human X chromosome using microdissection clones"
iv) Dr. J.A. Todd - "Characterization of variant DNA markers from the mouse
genome"
No awards were made at the November meeting of the HGMP Directed Programme
Committee.
For your information the dates for the next Directed Programme Committees and
the subsequent deadlines for any project grant applications are as follows:
Directed Programme Committee Deadline for Project Grant Applications
27th February 1991 29th January 1991
21st May 1991 22nd April 1991
Further guidance on the areas of work that are eligible for HGMP project grants
The directed programme of research supports projects that are aimed
either at making a direct contribution to genome mapping or at developing
enabling techniques. Since the initial call for proposals was issued in April
1989 (GTA Note No. 244), 83 proposals have been considered by the Directed
Programme Committee and 48 grants costing over #6.3m have been awarded. While
the majority have been three year grants, some awards have been for pilot
studies and for major equipment.
The grants awarded by the Directed Programme Committee to date have
brought about a selective expansion within the UK of genetics research relevant
to the mapping of the human genome. In future, HGMP support will be more
focused and in the first instance the highest priority will be given to the
following areas:
(i) Genome analysis - This includes projects that can be seen as representing a
contribution to general genome mapping. Projects that have as their primary
objective the isolation and characterization of a specific gene or gene cluster
do not, therefore, qualify for HGMP funding. The HGMP may, however,
occasionally support projects involving the systematic mapping of substantial
segments of DNA, provided that there is a clear intention to contribute to
genome mapping and not just to isolate one particular gene from within the
segment in question.
In addition to studies on the human genome itself, support will be
given to equivalent studies of the mouse genome, since it is considered that
the results obtained will facilitate the analysis of the human genetic
complement. Support for work on the genomes of other species will depend on a
strategic case being argued.
(ii) Technical development - projects aimed at the development of new enabling
technologies e.g. vectors, cloning hosts, reagents, computer software
techniques and scientific equipment, especially when there is likely to be a
significant pay-off in the short-term, for the benefit of the other parts of
the Project.
(iii) Evaluation of techniques and equipment - work that involves the
application of newly-developed techniques and equipment within genome analysis
projects, in order to assess whether they offer advantages over the existing
(or other novel) methodologies.
(iv) Studies of specific structures within the genome - projects that involve
the study of particular structural arrangements or sequences within the genome,
with a view to developing new methodologies that utilize these structures for
genome analysis.
An overall guide is that in order for a project to qualify for HGMP
support there should be a reasonable likelihood that it will generate
scientific findings, technical information or experimental resources that would
be of value to the genome mapping community, as a whole, rather than just to
those researchers working on a particular gene or gene cluster.
11) 1991 HGMP RESEARCH STUDENTSHIP AWARDS
Department and No. of Awards Supervisor(s) Project Title
Institution
1 Dr. R.D. Sutcliffe 1 Dr. K. Kaiser
Genetics, Glasgow
Reverse genetics of Drosophila
2 Professor J.H. Edwards 1 Dr. G.K. Brown
Genetics Laboratory,
Biochemistry, Oxford
Patterns of X-inactivation and manifestation of X-linked diseases in
human females in relation to genes in the region of Xp22.1
3 Professor A.B. Rickinson 1 Dr. A.M.R. Taylor
Cancer Studies,
Medical School, Birmingham
Mapping and cloning the gene for ataxia telangiectasia
4 Professor H.J. Evans 1 Dr. R. Allshire
MRC Human Genetics Unit
Edinburgh
The construction of artificial chromosomes in S.pombe for cloning large
DNA fragments
5 Professor R.P. Ambler 1 Dr. D. Leach
Institute of Cell and Molecular
Biology, Edinburgh
Illegitimate recombination in E.coli
6 Dr. K.B.M. Reid 1 Dr. R.D. Campbell
MRC Immunochemistry Unit
Oxford
Cloning of genes in the human Major Histocompatability Complex class III
region by use of novel techniques
7 Dr. J. Wyke 1 Dr. A. Balmain
Beatson Institute for Cancer
Research, Glasgow
Identification of potential tumour suppressor genes by microsatellite
deletion mapping in rodent and human tumours
8 Professor P.S. Harper 1 Dr. M. Upadhyaya
Institute of Medical Genetics, Dr. M.J. Owen
University of Wales
College of Medicine
Isolation of the gene for Charcot-Marie-Tooth (CMT) disease type I
9 Dr. B.M. Cattanach 1 Dr. J. Peters or
Genetics, MRC Radiobiology Unit Dr. Y. Boyd
(a) Mapping the regions of mouse chromosome 2 that are subject to
parental imprinting
(b) The comparative genetic organisation of sequences conserved between
man and mouse
To be chosen from:
10 R.D.A. Hopkinson 1 Dr. C. Abbott or
MRC Human Biochemical Professor E.B. Robson
Genetics Unit and Genetics Dr. B. Carritt or
and Biometry UCL
(a) Cloning developmental mutant genes on mouse
chromosome 2
(b) Physical mapping and organisation of human Rhesus gene
Dr. J.D.A. Delhanty
(c) Detailed mapping of human chromosome 9q with particular reference to
the isolation of the gene for tuberous sclerosis
Dr. D.M. Swallow or
(d) Determination of gene order within a closely linked gene cluster on
human chromosome 11p15, which includes HRAS, INS HBB and MUCZ by family
genetic methods
Prof. E.B. Robson
(e) Linkage map of chromosome 1
or Dr. J. Wolfe
(f) Construction of a contig map of the human Y chromosome
11 Professor E. Southern 1 Dr. W.R.A. Brown
Biochemistry, Oxford
Telomere directed chromosome breakage as a tool in human genome mapping
12 Dr. N.A. Roseneyer 1 Dr. J. Thornton
Biochemistry and Molecular
Biology, University College
London
Protein sequence and structure analysis using an integrated database of
sequence and structural data
13 Dr. S.S. Bhatlacharya 1 M.Sc studentship
Molecular Genetics Unit for Medical
Newcastle upon Tyne Genetics Course
APPENDIX I: List of Contributors
Dr. Nigel K. Spurr
Imperial Cancer Research Fund
Clare Hall Laboratories
Blanche Lane
South Mimms,
Potters Bar,
Herts. EN6 3LD
Tel.No: 0707-44444 Ext. 353
Fax: 0707-49527
Tony Vickers
HGMP Resource Centre
Watford Road
Harrow
Middlesex HA1 3UJ
Tel.No: 081-869 3809
Fax: 081-869 3807
MRC Clinical Research Centre (Director: Dr. K.E. Kirkham OBE)
Watford Road
Harrow
Middlesex HA1 3UJ
Tel.No: 081-869 3232
Fax: 081-423 1275
Heads of Divisions and Sections involved in molecular genetics:
Dr. C. Danpure, Biochemical Genetics Research Group
Dr. M. Farrall, Division of Molecular Medicine
Dr. S. Rastan, Division of Comparative Biology
Dr. J. Scott, Division of Molecular Medicine
Dr. E. Simpson, Section of Transplantation Biology
Dr. R. Thakker, Division of Molecular Medicine, Mineral and Endocrine
Disorders Research Group
Dr. E. Tuddenham, Haemostasis Research Group
Dr. A. Vickers, human Genome Mapping Project Resource Centre
Dr. R. Winter, Division of Molecular Medicine [Clinical Genetics
(Dysmorphology) Research Group]
Dr. P. Woo, Section of Molecular Rheumatology
Imperial Cancer Research Fund
P.O. Box 123
Lincoln's Inn Fields,
London WC2A 3PX
Tel.No: 071-242 0200
Fax: 071-405 1556
Laboratory of Human Molecular Genetics (Dr. Peter Goodfellow)
Human Immunogenetics Laboratory (Dr. John Trowsdale)
Genome Analysis Laboratory (Dr. Hans Lehrach)
Human Cytogenetics Laboratory (Dr. Denise Sheer)
Molecular Analysis of Mammalian Mutation Laboratory (Dr. A-M.
Frischauf)
Charing Cross Hospital (Dr. Keith Johnson)
Department of Anatomy
Charing Cross and Westminster Medical School
Fulham Palace Road
London W6 8RF
Tel.No: 071-846 7038
Fax: 071-846 7025
St. Bartholomew's Hospital (Professor David J. Galton)
Department of Human Genetics and Metabolism
(Diabetes and Lipid Laboratory)
St. Bartholomew's Hospital
West Smithfield
London EC1A 7BE
Tel.No: 071-601 8888 Ext. 8432
Fax: 071-601 8042
St. Mary's Hospital Medical School (Professor Bob Williamson/Dr. Peter
Scambler)
Cystic Fibrosis Research Group
Department of Biochemistry & Molecular Genetics
St. Mary's Hospital Medical School
Norfolk Place
London W2 1PG
Tel.No: 071-723 1252
Fax: 071-706 3272
Institute of Child Health (Dr. Sue Malcolm)
Mothercare Department of Paediatric Genetics
Institute of Child Health
University of London
30 Guilford Street
London WC1N 1EH
Tel.No: 071-242 9789
Fax: 071-831 0488
Mount Vernon Hospital (Dr. Janet Arrand)
Molecular Biology Group
CRC Gray Laboratory
P.O. Box 100
Mount Vernon Hospital
Northwood
Middlesex. HA6 2JR
Tel.No: 09274-28611
Fax: 0923-835210
The Galton Laboratory, University College London
The Galton Laboratory
University College London
Wolfson House
4 Stephenson Way
London NW1 2HE
Tel.No: 071-387 7050
Fax: 071-387 3496
Comprising the MRC Human Biochemical Genetics Unit (Director Dr. D.
Hopkinson) and the Department of Genetics and Biometry, University College
London (Head of Department Dr. J.S. Jones).
University College & Middlesex School of Medicine
a) Dr. Georg Melmer
Department of Psychiatry
Wolfson Building
Riding House Street
London W1N 4LJ
b) Professor J.L.H. O'Riordan
Department of Medicine
University College and Middlesex School of Medicine
Middlesex Hospital
Mortimer Street
London W1N 8AA
Royal Postgraduate Medical School, Hammersmith Hospital (Dr. L. Luzzatto)
Department of Haematology and MRC/LRF Leukaemia Unit
Royal Postgraduate Medical School
Hammersmith Hospital
Ducane Road
London W12 0NN
Tel.No: 081-740 3234
Fax: 081-740 9679
United Medical and Dental Schools of Guy's & St. Thomas's Hospitals (Prof. M.
Bobrow)
Paediatric Research Unit
Division of Medical and Molecular Genetics
United Medical and Dental Schools of Guy's and St. Thomas's Hospitals
Prince Philip Research Laboratories
7th & 8th Floors, Guy's Tower
Guy's Hospital
London SE1 9RT
Tel.No: 071-955 4456
Fax: 071-955 4644
Institute of Neurology (Professor Louis Lim & Dr. Christine Hall)
Department of Neurochemistry
Institute of Neurology
1, Wakefield Street,
London WC1N 1PJ
Tel.No: 071-278 1552
Fax: 071-278 7045
London School of Hygiene and Tropical Medicine (Dr. Neil Stoker)
Department of Clinical Sciences
London School of Hygiene and Tropical Medicine
Keppel Street
London WC1E 7HT
Tel.No: 071-636 8636
Fax: 071-436 5389
Imperial College of Science Technology and Medicine
Dr. Peter Little
Dept. of Biochemistry
Imperial College
London SW7 2AZ
Tel.No: 071-823 7518
Fax: 071-823 7525
THE EUROPEAN COLLABORATIVE INTERSPECIFIC BACKCROSS - A FACILITY FOR MAPPING THE
MOUSE GENOME
Dr. Stephen Brown
Dept. of Biochemistry and Molecular Genetics
St. Mary's Hospital Medical School
London W2 1PG
Tel.No: 071-723 1252 Ext. 5484
Fax: 071-706 3272
OLIGONUCLEOTIDE PRIMERS FOR PCR ANALYSIS OF MOUSE MICROSATELLITES
C. Hearne, M. McAleer, J. Love, A. Knight, T. Aitman, R. Cornall,
J.-B. Prins, S. Ghosh and J. Todd
Nuffield Dept. of Surgery
John Radcliffe Hospital
Headington
Oxford OX3 9DU
Tel: 0865-220145
FAX: 0865-68876
APPENDIX II
MOUSE CHROMOSOME SPECIFIC MICROSATELLITES
------------------------------------------------------------------------
Sequence Locus Chromosome Primer sequences
(map
location,cM)
------------------------------------------------------------------------
PCR Repeat unit Size variation;
product Mg2+/annealing temp.
size (bp) (mM) (C)
------------------------------------------------------------------------
50.MUSACHRA Acrg 1(17) ACCGTTCACAGCTGACCTAGT
GGGACACAGATGTACTAAGCT
112 (CA)12 B6/J=B6.PL>NON=DBA/2J=NOD=B10/W>SPE
4/55
*119.M22871 Crp 1(71) AGAATCTGACTTACCCATGGT
GAGGGAGAAGAATTATGTCTG
143 (AT)12 NOD=NON>SPE=DBA/2J>B6/J=B10/W;
4/55
*73.MMADAP Ada 2(67) CCGGGAAATGCGCGCCAGAGT
GGTCGCTTCCCGATGGCTCTCAGA
174 G22 NOD=B10/W=B6/J=NON=DBA/2J=AKR/J>SPE;
2/55
*138.MMIL01 Il-2 3(15) GTGCTCCTTGTCAACAGCGCA
CTCCTGTAGGTCCATCAACAGC
129 (CAG)12 B10/J>>SPE; 1/55
*89.MUSTSHBA2Tshb 3(63) TCTGAAGAGTTTGTCCTCATC
TGAATAAAGGACTCCTGAGCT
158 T27 NOD=AKR/J>B10/W=NON=B6/J=DBA/2J>SPE;
2/55
81.MUSAGP1A Orm-1 4(38) TTCTGGCCAACCTCTGTGCTT
CCCACAGTTGTCCTGTGACAT
132 (GT)28 B6.PL=B10/W>DBA/2J=NON=NOD>SPE; AGAROSE
*216. Lck 4(57) GCAGATGGAATTCCTGTGCCA
ACACACAGAGACATGAGATTGGAT
340 HaeIII digestion SPE,NOD,DBA/2J,AKR,NON allele 1;
B6/J,B10/W,B6.PL allele 2; 1/55
106.MMIL6A Il-6 5(11) TGTATAGAGCCCAATAAAGTG
ACCATGCCCAGCCTAATCTAG
81 (CA)X SPE>B10/W=NOD=B6/J=NON=DBA/2J;
2/55
70.MMFTPR Afp 5(46) AGCAGGGCTACACAGAGAAAC
ATTCCCATATTTGCATCTCCA
95 A38 NOD=DBA/2J>B10/W=B6/J>NON>SPE;
5/55
19.MMNGFG2 Ngfg 7(21) CTCCACATGTGTATGTGTATG
ATGGAGGCCGAAGAAAGAATC
147 (TC)26 SPE>B6.PL=B10/W>NOD=NON;
1/60
9.MMINT2 Int-2 7(74) GTGACAATACATTCCTGCTGT
CTCAGATCTTATCTCTAGCAC
161 (GT)23 B10/W=NOD=B6/J=NON=B6.PL>SPE>DBA/2J;
2/55
25.MMCD46 Ly-4 6(56) AGGAGAGGATTAACTCTTGAA
CATGCATGTGTGCAACATGCG
123 (CA)11 B6/J=DBA/2J=NOD=NON=CBA=B6.PL=
B10/W>> SPE; 2/55
10.MMMETII Mt-2 8(35) CATGCAGAAGCATGCATTGGTCA
AAGCTTACGGTTTAATCC
121 (TG)24 NOD>B10/W=NON=B6/J=
DBA/2J>SPE; 3/55
34.MMCYO3 Cypla2 9(28) AGTTTTAGGCTAGTATAGGTT
ACTGGAACCTTAGAGCATGAG
198 (CAAG)11 SPE>B10/W=B6.PL=B6/J=NON>NOD=DBA/2J;
1/55
4.MMGLN1 Glns 11(10) AGCTTTGGAGACAACAATTAGATC
TGTTCATCAGCTGAGGAATGGATG
181 (GT)20 SPE>B6/J=B6.PL=B10/W>NOD=DBA/2J;
1/55
5.MMHOX23R Hox-2 11(54) CCTTGCATTCTGAGGCTGAAGGAC
TCAGAAGTCTTGCGCTGCATC
218 (GT)24 SPE>B6.PL=B10/W=NON=NOD>DBA/2J;
1/55
*140.MMODCC Odc 12(4) CATTTGAGGACAGTCAGGATC
GGAACTTTCATGCAGTACTAG
175 POLY T NOD>NON=AKR/J=DBA/2J>>B6/J=B10/J>>SPE;
2/55
1.MMIGVH16 Igh-V 12(73) ACATGGTAATTTATGGGCAA
CTGGATACCTGCAATAGTAGA
148 (GT)28 B6/J=NOD=B6.PL=B10/W>NON=SPE>DBA/2J;
3/55
29.MMUPAA Plau 14(5) TGCTGGCTAGGAATAAACAGA
AGGGAATTCATGTTCAGGATA
188 (GA)29 DBA/2J>SPE=NON=NOD>B6.PL=B10/W=B6/J;
2/55
*120. hr 14(27) CCACCCTGGAATCTTCCGTGA
TTGCTGTGGAGAGTGCGTGCA
143 (GT)16 CBA=DBA=B6/J=AKR=B10/J=C3H=SWR=NOD;
1.5/55
13.MMMYCE12 Myc 15(18) CGTCACTGATAGTAGGGAGTA
TCAGCGTGCTGTACTTCCAAG
107 (CA)20 B6.PL=B6/J=B10/W=DBA/2J=NON>NOD; 1/55
B6/J>>SPE(50C)
43.MMHOX31R Hox-3 15(48) TTCCTGCTCCCACCTTCTGAG
GAATCATCTTCTATATCTTCAGG
166 (CA)19 SPE>B10/W=B6.PL=B6/J=NON>NOD=DBA/2J;
1/55
*192.TJ+2.133D16Nds2 16(49) ATTGGTGAGCTTACAGAATAC
GTGGTCATGATATTCGTAGAT
90 (CA)23 DBA/2J>>B10/W=B6.PL=B6/J>>NOD=
NON=AKR/J>SPE; 1/55
22.MMTNFAB Tnfb 17(19) TTCCTGTGGCGGCCTTATCAG
AGACAATGGGTAACAGAGGCA
135 (TC)28C2(TC)12 B6/J=B6.PL>B10/W=NOD=NON=DBA/2J>SPE;
TT(CT)5 1/55
36.MMBPS2 Mbp 18(57) CAGTACAGCCAGGACACAGAA
ATGGCTGACCAACTCTCTAGC
144 (CA)17 SPE>NOD=B6.PL=B10/W=CBA=B6/J=DBA/2J=NON;
1/55
*121.MMIIGC Ii 18 GGTGCCAAATGGTCAGTCCTG
GCTTCACTTCAAATTCATGGC
158 (AT)6 B6.PL>NON>SPE>B10/W>NOD=B6/J=DBA/2J;
1.5/55
26.MMREPGT4 Hprt X(23) TGACAACTTCTGTCCTCAACA
ATGCCGTCCTTTATCTAGAAC
97 (CA)14 SPE>NOD=NON>B6.PL=B10/W=CBA=DBA/2J=B6/J;
4/55
11.MMPLP7A Plp X(56) TAATATAACAGATAACCAACCATTC
CATTTTGTAAGATGAGTTTCTA
120 (CA)13 SPE>>CBA=NOD=NON=B6.PL=B10/W=B6/J=DBA/2J;
2/55
>> = agarose resolvable
* unpublished data
--
GARY WILLIAMS, Computing Services Section, Janet: G.Williams@UK.AC.CRC
MRC-CRC & Human Genome Mapping Centre, Internet: G.Williams@CRC.AC.UK
Watford Rd, HARROW, Middx, HA1 3UJ, UK EARN/Bitnet: G.Williams%CRC@UKACRL
Tel 081-869 3294 Fax 081-423 1275 Usenet: ...!mcsun!ukc!mrccrc!G.Williams