UMELCHER@BIONET-20.BIO.NET (Ulrich K. Melcher) (05/06/89)
Puppy Version 2.1 Available for Macintosh Create eye-catching, readable, and space-efficient representations of nucleotide sequences using the "Puppy" representation originally described in CABIOS 4: 93-96 (1988). Tired of "CCCGGGGCCCCCAAAATTTCGCGC"? Try something completely different! Version 2 for the Macintosh differs from version 1 in several respects. It is much faster. It allows printing in both horizontal and vertical orientations on either Imagewriters or Laserprinters. It allows side-by-side comparison of related sequences, highlighting differences. Version 2.1 differs from version 2.0 only in the correction of several minor bugs. To receive your copy of the program, source listing, and documentation, please send your request, a blank disc, and (if in USA) postage to me at the address below. Ulrich Melcher Department of Biochemsitry Oklahoma State University Stillwater, Oklahoma 74078-0454 USA -------