[bionet.software] Puppy representations of sequences

UMELCHER@BIONET-20.BIO.NET (Ulrich K. Melcher) (05/06/89)

		Puppy Version 2.1 Available for Macintosh

	Create eye-catching, readable, and space-efficient representations of
nucleotide sequences using the "Puppy" representation originally described in
CABIOS 4: 93-96 (1988).  Tired of "CCCGGGGCCCCCAAAATTTCGCGC"?  Try something 
completely different!

	Version 2 for the Macintosh differs from version 1 in several respects. 
It is much faster.  It allows printing in both horizontal and vertical
orientations on either Imagewriters or Laserprinters.  It allows side-by-side
comparison of related sequences, highlighting differences.  Version 2.1 differs from version 2.0 only in the correction of several minor bugs.

	To receive your copy of the program, source listing, and documentation, 
please send your request, a blank disc, and (if in USA) postage to me at the
address below.

				Ulrich Melcher
				Department of Biochemsitry
				Oklahoma State University
				Stillwater, Oklahoma 74078-0454
				USA

-------