roy@phri.nyu.edu (Roy Smith) (11/25/90)
larry@kitty.UUCP (Larry Lippman) writes: > I feel confident that 300-year old blood can be reliably identified *as > blood*, I am highly doubtful that any species identification can be made. Would it be possible to recover enough DNA to do PCR on it? I seem to remember reading something about doing PCR on DNA from a frozen quagga (a zebra-like beast which became extinct in the last ice age, now only found on "rogue" games). The quagga DNA was O(10,000) years old, which is considerably older than 300 years, but perhaps freezing is a better method of preserving than drying on paper? Assuming you could do PCR, how hard would it be to determine the species? The most likely other candidates would probably be some sort of food animal, such as cow, pig, or chicken (or whatever animals they were eating 300 years ago; the point is, other primates would be unlikely). Actually, it just occurred to me that red blood cells don't have DNA, if I remember correctly, but maybe some other component of blood does? Now, about "Pool P", everybody knows that the way to detect it is to look for the warm spots. :-) -- Roy Smith, Public Health Research Institute 455 First Avenue, New York, NY 10016 roy@alanine.phri.nyu.edu -OR- {att,cmcl2,rutgers,hombre}!phri!roy "Arcane? Did you say arcane? It wouldn't be Unix if it wasn't arcane!"
forbes@aries.scs.uiuc.edu (Jeff Forbes) (11/26/90)
In article <1990Nov25.154239.17434@phri.nyu.edu> roy@phri.nyu.edu (Roy Smith) writes: >Actually, it just occurred to me that red blood cells don't have DNA, if I >remember correctly, but maybe some other component of blood does? You are correct. Mammalian erythrocytes do not have a nucleus and therefore no DNA. Other cellular components of blood do have a nucleus, but the concentration is much less than the erythrocytes. Avian erythrocytes do have a nucleus. Jeff Forbes "....I have not failed. I've just found 10,000 ways that won't work." Thomas Edison
andrewt@cs.su.oz (Andrew Taylor) (11/26/90)
In article <1990Nov25.154239.17434@phri.nyu.edu> roy@phri.nyu.edu (Roy Smith) writes: > Would it be possible to recover enough DNA to do PCR on it? I seem > to remember reading something about doing PCR on DNA from a frozen quagga > (a zebra-like beast which became extinct in the last ice age, now only > found on "rogue" games). Quaggas became extinct about 100 years ago (in Southern Africa). Maybe you have the wrong animal?
larry@kitty.UUCP (Larry Lippman) (11/26/90)
In article <1990Nov25.154239.17434@phri.nyu.edu>, roy@phri.nyu.edu (Roy Smith) writes: > larry@kitty.UUCP (Larry Lippman) writes: > > I feel confident that 300-year old blood can be reliably identified *as > > blood*, I am highly doubtful that any species identification can be made. > > Would it be possible to recover enough DNA to do PCR on it? I don't believe that any DNA fragments would exist in the dry condition of a 300-year old blood stain, notwithstanding the fact that mature mammalian erythrocytes don't have a nucleus, mitochondria, ribosomes, etc. Leucocytes are a true cell with a nucleus and DNA, but I rather doubt that any would be found in a 300-year old blood stain. I can't offer any authoritative comments on DNA issues, though. I don't do DNA, genetic mapping or any aspect of molecular biology. I have enough trouble maintaining competency in selected more traditional aspects of chemistry and biochemistry! :-) > Actually, it just occurred to me that red blood cells don't have DNA, if I > remember correctly, but maybe some other component of blood does? As far as I can recall, no *mature* mammalian erythrocytes possess DNA. Erythrocytes of birds, reptiles, etc. do have a nucleus with DNA and all the trimmings, though. > Now, about "Pool P", everybody knows that the way to detect it is > to look for the warm spots. :-) That's the solution! An IR thermographic imaging system coupled with a VCR to catch the perpetrator in the act! Showing instant replays would probably be more embarrassing than any chemical indicator... :-) Larry Lippman @ Recognition Research Corp. "Have you hugged your cat today?" VOICE: 716/688-1231 {boulder, rutgers, watmath}!ub!kitty!larry FAX: 716/741-9635 {utzoo, uunet}!/ \aerion!larry
eesnyder@boulder.Colorado.EDU (Eric E. Snyder) (11/27/90)
In article <4200@kitty.UUCP> larry@kitty.UUCP (Larry Lippman) writes: >In article <1990Nov25.154239.17434@phri.nyu.edu>, roy@phri.nyu.edu (Roy Smith) writes: >> Would it be possible to recover enough DNA to do PCR on it? > > I don't believe that any DNA fragments would exist in the dry >condition of a 300-year old blood stain..... I bet there would be PCRable DNA fragments.... Remember that DNA is a remarkably stable molecule (even in my hands). Furthermore, PCR only requires a few molecules of template to give a signal... that is not too much to ask. One could easily do species ID by selecting a highly polymorphic locus such as beta-casein and sequencing the amplified product. --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder Department of MCD Biology We are not suspicious enough University of Colorado, Boulder of words, and calamity strikes. Boulder, Colorado 80309-0347 LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
ireland@ac.dal.ca (11/28/90)
In article <1516@cluster.cs.su.oz.au>, andrewt@cs.su.oz (Andrew Taylor) writes: > In article <1990Nov25.154239.17434@phri.nyu.edu> roy@phri.nyu.edu (Roy Smith) > writes: >> Would it be possible to recover enough DNA to do PCR on it? I seem >> to remember reading something about doing PCR on DNA from a frozen quagga >> (a zebra-like beast which became extinct in the last ice age, now only >> found on "rogue" games). > > Quaggas became extinct about 100 years ago (in Southern Africa). Maybe > you have the wrong animal? If I remember correctly, two different experiments are being confused here. The quagga DNA came from a museum specimen, possibly a hide. The PCR done on DNA isolated from a beast which was frozen and extinct from the last ice age came from a wooly mammoth. Keith Conover ireland@ac.dal.ca