davisonj@EN.ECN.PURDUE.EDU (John M Davison) (08/21/90)
In the Spring of 1990 I worked on a presentation on computer
music, and during the preparation I corresponded with a great number
of people on the net, virtually all of whom were very helpful,
considerate, and in short, a joy to have around.
It has been suggested that I pass along the correspondence
that took place during this period, that others may find some useful
information somewhere within all this text. Well, here it is; glean
from it what you can.
I would especially like to thank the following people for
helping me out:
John Boyd
Tom Granvold
Marc LoCascio
K. Richard Magilla
Paul McAvinney
Mike O'Brien
Christopher Penrose ***
Neil Rolnick
Adam Schabtach
Carter Scholz
...and the gentleman who mailed me the Yamaha soundsheet
...and the MIT Media Lab
Please forgive me if I have made any omissions in my list of
people who deserve to be lauded for their assistance.
-----CUT-HERE-------------------------------------------------------------------
From Paul.McAvinney@A.GP.CS.CMU.EDU Fri Apr 6 23:26:03 1990
Received: from A.GP.CS.CMU.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA13916; Fri, 6 Apr 90 23:26:01 -0500
Date: Sat, 7 Apr 1990 00:10-EDT
From: Paul.McAvinney@A.GP.CS.CMU.EDU
To: John M Davison <davisonj@en.ecn.purdue.edu>
Subject: Re: Videoharp demo inquiry
Message-Id: <639461448/pm@A.GP.CS.CMU.EDU>
In-Reply-To: John M Davison's mail message of Fri, 6 Apr 90 21:44:10 -0500
Cc: rubine@K.GP.CS.CMU.EDU
Status: RO
John:
I recently made a VHS videotape using VideoHarp No. 3, the
last handmake VideoHarp to be built before we begin limited production
in June (The one on the cover of CMJ is VideoHarp No. 1). To get a copy,
call Sandy Balough at Sensor Frame Corporation in Pittsburgh,
(412)-683-9500 on weekdays between 9:30AM and 5PM. She'll put you on our
mailing list. Tell her I said to send a tape free. Whether one would
describe my playing of the VideoHarp as "music" is a matter of opinion,
but the tape at least illustrates most of the capabilities of the harp
(except strumming).
Paul
From ceej@pawl.rpi.edu Sun Apr 8 17:23:20 1990
Received: from rpi.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA29206; Sun, 8 Apr 90 17:23:13 -0500
Received: from pawl.rpi.edu (imagine.pawl.rpi.edu) by rpi.edu (4.1/SM42-RPI-ITS);
id AA08997; Sun, 8 Apr 90 18:22:18 EDT for davisonj@en.ecn.purdue.edu
Received: from sub.pawl.rpi.edu (pawl3.pawl.rpi.edu) by pawl.rpi.edu (4.1/HUB10);
id AA14578; Sun, 8 Apr 90 18:20:27 EDT for davisonj@en.ecn.purdue.edu
From: Chris J Hillery <ceej@pawl.rpi.edu>
Received: by sub.pawl.rpi.edu (4.1/PSUB09);
id AA02013; Sun, 8 Apr 90 18:21:34 EDT for davisonj@en.ecn.purdue.edu
Date: Sun, 8 Apr 90 18:21:34 EDT
Message-Id: <9004082221.AA02013@sub.pawl.rpi.edu>
To: davisonj@en.ecn.purdue.edu
Subject: Re: rolnick tape followup
Status: RO
That's odd... he did say he checks his mail nearly every night. I checked his
address again, here it is in case either of us got it wrong...
rolnick@iear.arts.rpi.edu
If that's what you mailed to, then I don't know what the problem is... I'll
ask him on Tuesday in class and see if he got any messages from you.
--
//..is|While 1 DO|Erin,Erin,where are|Art of Noise space| -- Ceej (=
\X/there| Fork; |you? /-----------.-^------------------|ceej@pawl.rpi.edu
AMIGAany|----------^-----|Cebhq gb or|Reclaimer:Hey!That's| gmry@mts.rpi.edu
(=other?|HOW DO YOU FEEL.|Yvoreny! (=|mine! Bring it back!|aka Chris Hillery
From eesnyder@boulder.Colorado.EDU Mon Apr 9 08:36:02 1990
Received: from boulder.Colorado.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA12529; Mon, 9 Apr 90 08:35:59 -0500
Return-Path: <eesnyder@boulder.Colorado.EDU>
Received: by boulder.Colorado.EDU (cu-hub.890824)
Received: by beagle.colorado.edu (cu.generic.890828)
Date: Mon, 9 Apr 90 06:35:47 -0700
From: Eric E. Snyder <eesnyder@boulder.Colorado.EDU>
Message-Id: <9004091335.AA07177@beagle.colorado.edu>
To: davisonj@en.ecn.purdue.edu
Subject: Re: DNA music request
Cc: eesnyder@boulder.Colorado.EDU
Status: RO
John,
Thank you for your interest in my "DNA music".
Have you commercially released any of the results of your
work? I would very much like to use your work in my presentation. Do
you have any demonstration cassettes available? If I were to send you
a blank audio cassette, would you send me some music that is
representative of the technique of working with DNA sequences? Any
material, even if it is just a few paragraphs of written text, would
be helpful.
While I haven't released any music commercially (not for lack of trying)
I have distributed a few cassettes to interested parties over the net and
would be more than happy to provide you with a demo cassette. You can
send me a cassette or, if you are in a hurry, I can send you a tape now
and you can reimburse me for the cost. I can also provide you with a
written description of the algorithm I have used to create the music as
well as the MIDI set-up and instrumentation.
I look forward to hearing from you.
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder
Department of Biochemistry Proctoscopy recapitulates
University of Colorado, Boulder hagiography.
Boulder, Colorado 80309
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------
From eesnyder@boulder.Colorado.EDU Wed Apr 11 11:14:28 1990
Received: from boulder.Colorado.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA17496; Wed, 11 Apr 90 11:14:24 -0500
Return-Path: <eesnyder@boulder.Colorado.EDU>
Received: by boulder.Colorado.EDU (cu-hub.890824)
Received: by beagle.colorado.edu (cu.generic.890828)
Date: Wed, 11 Apr 90 09:13:42 -0700
From: Eric E. Snyder <eesnyder@boulder.Colorado.EDU>
Message-Id: <9004111613.AA02609@beagle.colorado.edu>
To: davisonj@en.ecn.purdue.edu
Subject: Music and Notes
Status: RO
John,
I have made a demo tape of some DNA music and should be sending it out today.
I have also prepared some notes on the songs and theory which you will
find below. I wipped this out pretty quickly so if anything is unclear,
please write and I can probably explain it more coherently. You might
edit the biographical notes, they sound pretty silly.
Anyway, hope this helps.
Eric E. Snyder
#106, 2121 Canyon Boulevard
Boulder, CO 80302-4542
eesnyder@boulder.colorado.edu
11.04.1990 10.00
John Davison
2450 Sycamore Lane Apt. 25A
West Lafayette, IN 47906-1974
Side A
1. Mouse, rat, bovine kappa-casein
2. Human transferrin
3. HIV-1
4. Xenopus histone H1
5. Xenopus histone H1, variation
Side B
1. pUC19a
2. E. coli galactose receptor
Introductory Notes:
A program was used to code the DNA sequences so that they could be
read into a MIDI sequencer program, Roland MESA. This allows the
basic score to be easily manipulated. The output yields a single
line of music-- a simple string of quarter notes, one after
another. Using the editor, it is possible to overlay several
sequences to create complex chord structures. This also permits
keys to be transposed easily and timing parameters to be changed in
real-time.
Song Notes:
The first piece on side A is a good example. The three different
genes were coded separately then overlaid using the sequence
editor. The genes are homologous and therefore somewhat related,
possibly contributing to its musical character.
The second piece is similar except the three musical lines are
derived from a single DNA sequence, translated with slightly
different scaling parameters. The tempo remains constant
throughout the piece, however tonal parameters on the synthesizer
(Roland D50) are changed manually during the performance.
The next two pieces are played using the separate channel function
of the D50. Multiple lines of music are fed to the synthesizer on
multiple MIDI channels allowing separate control of two different
voices. As above, tonal parameter of the synthesizer are modified
during the performance.
The final piece on side A takes the basic score of the previous
track and drives the synthesizer in "chase" mode. This basically
creates a very long delay separating upper and lower synthesizer
voices and repeating them in a similar time scale. A few notes at
a time are fed to the synthesizer and they are allowed to repeat
and slowly fade away as new notes are added.
The first piece on side A (pUC19a, an E. coli cloning vector) takes
a small subsequence of pUC19a, translated as before, and overlaid
multiple times, offset in pitch and time. The bizarre chords which
result contribute to the "spooky" sound.
The final piece, is a simple translation of the gene sequence for
the E. coli galactose receptor, played through the D50 in chase
mode in concert with an analog piano module. The tempo of MIDI
input to the synthesizer is very slow, about 8 notes/ minute. The
delay allows these notes to build on each other; slight changes in
phase between instrument and computer cause the notes to be drawn
out slightly relative to each other, contributing to the sweeping
feel of the note clusters.
Compositional Theory:
The scaling function which sets the distance between successive
notes is very important. It became clear early on that simply
stepping one note up for the nucleotide "A", two notes down for a
"G", etc. was not a very satisfactory approach. I ended up
adapting a function which approximates the 1/f-spectral density
observed to occur in most music (Peitgen, H-O, Saupe, D, The
Science of Fractal Images, Springer-Verlag, 1988, p40-45). A
similar function was applied to the MIDI velocity parameter, giving
the music a more "human" feel.
Biographical Notes:
Eric Snyder is a graduate student in biochemistry at the University
of Colorado at Boulder. He started his scientific career at Johns
Hopkins University in Baltimore, Maryland, studying psychology and
molecular biology. He is currently investigating the structural
and energetic parameters governing the binding of ions to
macromolecules by genetic engineering and computer modeling. He
has publish his work in Biochemistry and Biochemical Education and
is currently preparing recent work on mutagenesis studies of the E.
coli galactose receptor for submission to Science.
He has a wide range of musical tastes but has been particularly
inspired by the work of Brian Eno and Robert Fripp. In addition to
his interest in computer musical composition, he is frequently seen
playing Bluegrass guitar in the mountains around Boulder.
From decvax!pyramid!garth!tom@ucbvax.Berkeley.EDU Wed Apr 11 19:33:14 1990
Received: from ucbvax.Berkeley.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA05464; Wed, 11 Apr 90 19:33:09 -0500
Received: from decvax.UUCP by ucbvax.Berkeley.EDU (5.61/1.41)
id AA10297; Wed, 11 Apr 90 17:19:21 -0700
Received: by decwrl.dec.com; id AA27441; Wed, 11 Apr 90 11:17:02 -0700
Received: by pyramid.pyramid.com (5.61/OSx5.0-890710)
id AA26108; Wed, 11 Apr 90 10:44:01 -0700
Received: by apd.ingr.com (5.61/INGR-1.1)
id AA20654; Wed, 11 Apr 90 10:07:44 -0700
Date: Wed, 11 Apr 90 10:07:44 -0700
From: decvax!garth!tom@ucbvax.Berkeley.EDU (Tom Granvold)
Message-Id: <9004111707.AA20654@apd.ingr.com>
To: pyramid!EN.ECN.PURDUE.EDU!davisonj
Subject: Re: Computer music demonstration recordings needed -- READ ME
Status: RO
Newsgroups: comp.music
In-Reply-To: <9004010122.AA07990@en.ecn.purdue.edu>
Organization: INTERGRAPH (APD) -- Palo Alto, CA
Cc:
In article <9004010122.AA07990@en.ecn.purdue.edu> you write:
>
>I am currently preparing a presentation on computer music ("A Brief
>Overview of the History of Computer Music") to be given near the end
>of the semester (about four weeks from now). While I have a wealth of
>written sources from which to give a verbal presentation, I am sorely
>lacking in recorded examples of computer music.
>
>I am hunting for the following:
>
...
>
> recorded examples of the use of "alternate" controllers (Biomuse,
> Airdrums, wind controllers, breath controllers)
I have a 'record' that you can have, I don't even know why I kept it. It
is a demo from Yamaha of their wind controller. It consists of several short
pieces that show off the controller. It orginally came in the Electronic
Musicain magazine. Send a reply if you want it.
An interesting controller is a program that runs on the Amiga and Mac
called Music Mouse. It uses the mouse and keyboard to control the sounds
generated. It can use either the computer's internal sound generator or
output Midi commands. It is a lot of fun. I don't know if there any tapes
map using this. You can try the authors at:
Laurie Speigel & David Silver
Aesthetic Engineering
175 Duane St.
NY, NY 10013
(212)-925-7049
Another interesting controller is the new one from Buchla, called Thunder.
I have not seen it, but from what I have read it must be fantastic. Maybe
Buchla has a demo tape for it. By the way Morton Subontik, has worked with
Buchla for a long time.
Buchla and Associates
P.O. Box 10205
Berkeley, Calif. 94709
....
>
> recorded example of a piece composed for taped electronic music and
> live orchestra (or at least one live musician)
>
I don't know of any examples of this specific type of thing, but there is
something else. One of Wendy Carlos's compositions was written to be
performed by traditional instruments, an orchestra, or by synthersiers. I
know of one performance in Berkeley, Calif. where some movements were tapes
of synthesiers and others performed by an orchestra. There is a recording of
this piece, synthesier version only I believe, on Columbia Records called
Digital Moonscapes. See has done some very convincing instrumental sounds.
Also see here record/CD called Beauty and the Beast, the beast being the
synthesier, on New Albion Records I believe. Also she has done her version
of a thunder storm on the album Sonic Seasonings on Columbia Records.
...
Have fun,
------------------------------------------------------
Name: Tom Granvold
Mail: 2400 Geng Rd., Palo Alto, Calif., 94303
UUCP: ucbvax!decvax!decwrl!pyramid!garth!tom
------------------------------------------------------
-------
From eesnyder@boulder.Colorado.EDU Mon Apr 16 16:06:56 1990
Received: from boulder.Colorado.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA17430; Mon, 16 Apr 90 16:06:51 -0500
Return-Path: <eesnyder@boulder.Colorado.EDU>
Received: by boulder.Colorado.EDU (cu-hub.890824)
Received: by beagle.colorado.edu (cu.generic.890828)
Date: Mon, 16 Apr 90 14:06:22 -0700
From: Eric E. Snyder <eesnyder@boulder.Colorado.EDU>
Message-Id: <9004162106.AA25978@beagle.colorado.edu>
To: davisonj@en.ecn.purdue.edu
Subject: Re: DNA music request
Cc: eesnyder@boulder.Colorado.EDU
Status: RO
I am glad you like the music and hope it will contribute to your
presentation. $10 for the tape and recording time would be an
appropriate reimbursement. I would also like a final draft of your
work discussing my pieces, if possible. I am interested to know
how you presented it. Will any of this be published?
Thanks again for your interest.
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder
Department of Biochemistry Proctoscopy recapitulates
University of Colorado, Boulder hagiography.
Boulder, Colorado 80309
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------
From rolnick@iear.arts.rpi.edu Mon Apr 16 22:17:57 1990
Received: from rpi.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA19730; Mon, 16 Apr 90 22:17:52 -0500
Received: from iear.arts.rpi.edu by rpi.edu (4.1/SM42-RPI-ITS);
id AA15039; Mon, 16 Apr 90 23:16:47 EDT for davisonj@en.ecn.purdue.edu
Received: by iear.arts.rpi.edu (3.2/HUB10);
id AA08950; Mon, 16 Apr 90 23:17:14 EDT for davisonj@en.ecn.purdue.edu
Date: Mon, 16 Apr 90 23:17:14 EDT
From: Neil Rolnick <rolnick@iear.arts.rpi.edu>
Message-Id: <9004170317.AA08950@iear.arts.rpi.edu>
To: davisonj@en.ecn.purdue.edu
Subject: Re: Macedonian Airdrums tape
Status: RO
Sorry to have not gotten back to you. Yes, I'll send you a copy of the tape-
actually, a live performance of the piece at Princeton last weekend, and
maybe a tape with a few other performance pieces. Will get it out in the
next few days (things are very busy here, as everywhere. . .)
Chris hasn't mentioned anything else to me.
Let me know when the tape gets to you.
-- Neil
From penrose%do@ucsd.edu Tue Apr 17 16:57:05 1990
Received: from ucsd.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA28834; Tue, 17 Apr 90 16:57:00 -0500
Received: from do.ucsd.edu by ucsd.edu; id AA25228
sendmail 5.61/UCSD-2.0-sun via SMTP
Tue, 17 Apr 90 14:56:47 -0700 for davisonj@en.ecn.purdue.edu
Received: by do.ucsd.edu.UCSD.EDU (4.1/UCSDGENERIC.1)
id AA06720 for delivery to davisonj@en.ecn.purdue.edu; Tue, 17 Apr 90 14:57:21 PDT
Date: Tue, 17 Apr 90 14:57:21 PDT
From: penrose%do@ucsd.edu (Christopher Thomas Penrose)
Message-Id: <9004172157.AA06720@do.ucsd.edu.UCSD.EDU>
To: davisonj@en.ecn.purdue.edu
Subject: tape
Status: RO
I'll get it out ASAP. I have many others as well but it should be in the
mail tomorrow.
Christopher
From rolnick@iear.arts.rpi.edu Thu Apr 19 16:35:07 1990
Received: from rpi.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA16005; Thu, 19 Apr 90 16:35:04 -0500
Received: from iear.arts.rpi.edu by rpi.edu (4.1/SM42-RPI-ITS);
id AA25286; Thu, 19 Apr 90 17:34:01 EDT for davisonj@en.ecn.purdue.edu
Received: by iear.arts.rpi.edu (3.2/HUB10);
id AA14031; Thu, 19 Apr 90 17:34:26 EDT for davisonj@en.ecn.purdue.edu
Date: Thu, 19 Apr 90 17:34:26 EDT
From: Neil Rolnick <rolnick@iear.arts.rpi.edu>
Message-Id: <9004192134.AA14031@iear.arts.rpi.edu>
To: davisonj@en.ecn.purdue.edu
Subject: it's on it's way!
Status: RO
I had a tape of Macedonian AirDrummming, and another cassette with three
of my other performance pieces sent off today. All of the pieces are
performed live. A Robert Johnson Sampler and Balkanization are performed
from a MIDI keyboard, through which I manipulate samplers and synths
with some help from the Macintosh. Vocal Chords is done with a live singer,
whose voice I process in real time.
Please let me know when you get the tapes. If you could send $20 to cover
expenses and shipping it would be appreciated. Send to
Neil Rolnic
Neil Rolnick
152 Wittenberg Road
Bearsville, NY 12409
Also, I don't know if you have visiting artists or any similar programs at
purdue, but I do concerts (either solo or with student new music ensembles)
at a lot of schools, and have never done much in your part of the country --
mostly east & west coast, Chicago, Texas, etc. Anyway, if you have such a
program, perhaps there's someone I could contact either for 90-91 or 91-92?
Enjoy.
-Neil
From ceej@pawl.rpi.edu Fri Apr 20 14:59:18 1990
Received: from rpi.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA15702; Fri, 20 Apr 90 14:59:15 -0500
Received: from pawl.rpi.edu (imagine.pawl.rpi.edu) by rpi.edu (4.1/SM42-RPI-ITS);
id AA09542; Fri, 20 Apr 90 15:35:23 EDT for davisonj@en.ecn.purdue.edu
Received: from sub.pawl.rpi.edu (pawl4.pawl.rpi.edu) by pawl.rpi.edu (4.1/HUB10);
id AA01427; Fri, 20 Apr 90 15:31:54 EDT for davisonj@en.ecn.purdue.edu
From: Chris J Hillery <ceej@pawl.rpi.edu>
Received: by sub.pawl.rpi.edu (4.1/PSUB09);
id AA01478; Fri, 20 Apr 90 15:30:54 EDT for davisonj@en.ecn.purdue.edu
Date: Fri, 20 Apr 90 15:30:54 EDT
Message-Id: <9004201930.AA01478@sub.pawl.rpi.edu>
To: davisonj@en.ecn.purdue.edu
Subject: Re: rolnick tape followup
Status: RO
Well, I talked to him, again, and he said he'd written back to you, at last...
don't know what the holdup was, or on who's end it was; I hope you meant NEXT
Monday you needed the tape by, 'cause he said he can have it to you by then
(I assume he's told you this himself by now). (Next Monday=4/23)
At any rate, sorry for whatever the problem was, and good luck... let me know
how the project ends up!
//..is|While 1 DO|Erin,Erin,where are|Art of Noise space| -- Ceej (=
\X/there| Fork; |you? /-----------.-^------------------|ceej@pawl.rpi.edu
AMIGAany|----------^-----|Cebhq gb or|Reclaimer:Hey!That's| gmry@mts.rpi.edu
(=other?|HOW DO YOU FEEL.|Yvoreny! (=|mine! Bring it back!|aka Chris Hillery
From penrose%do@ucsd.edu Sun Apr 22 23:06:08 1990
Received: from ucsd.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA14272; Sun, 22 Apr 90 23:06:04 -0500
Received: from do.ucsd.edu by ucsd.edu; id AA23129
sendmail 5.61/UCSD-2.0-sun via SMTP
Sun, 22 Apr 90 21:06:00 -0700 for davisonj@en.ecn.purdue.edu
Received: by do.ucsd.edu.UCSD.EDU (4.1/UCSDGENERIC.1)
id AA22159 for delivery to davisonj@en.ecn.purdue.edu; Sun, 22 Apr 90 21:06:36 PDT
Date: Sun, 22 Apr 90 21:06:36 PDT
From: penrose%do@ucsd.edu (Christopher Thomas Penrose)
Message-Id: <9004230406.AA22159@do.ucsd.edu.UCSD.EDU>
To: davisonj@en.ecn.purdue.edu
Subject: tape
Status: RO
I've expressed your tape. I have been very busy and I am sorry for
the delay. I have a small sheet here that details some of the
gimmicks of CircusCircus. I hope it helps
Christopher
0"-40" time varying filtering applied to string quartet
27" time expanded vocal sound (sounds like a sheep)
50"-2'40"
From well!csz@apple.com Mon Apr 30 10:04:38 1990
Received: from apple.com by en.ecn.purdue.edu (5.61/1.21jrs)
id AA11553; Mon, 30 Apr 90 10:04:31 -0500
Received: by apple.com (5.61/25-eef)
id AB07904; Mon, 30 Apr 90 07:39:22 -0700
for
Received: by well.sf.ca.us (4.12/4.7)
id AA29401; Sun, 29 Apr 90 22:14:07 pdt
Date: Sun, 29 Apr 90 22:14:07 pdt
From: well!csz@apple.com (Carter Scholz)
Message-Id: <9004300514.AA29401@well.sf.ca.us>
To: eps@tektronix.TEK.COM, davisonj@en.ecn.purdue.edu
Subject: Re: Lots of Questions
Status: RO
1. What's the best PC-to-MIDI card available? Downward compatibility
Music Quest (800) 876-1376 or (214) 881-7408 for tech questions. Wide
range of MPU-401 compatibles, great tech support last time I checked.
2. Are there any reasonably affordable (i.e. <= $500) sound cards for
the PC? I would like to write some Music V-ish stuff on the IBM
No. Entry price for this stuff is >$1000. <$500 gives you MIDI-based
preset stuff.
3. What equipment do I need to start doing EPS sample editing on the
PC? My guess is that I would need a SCSI port on the PC, that
Wrong. You can up/download samples over MIDI. It's slow (1-2 mins for
a max-memory sample) but tolerable. Upgrading both the EPS & PC to SCSI
could go >$500 without software. The EPS has SCSI compatibility problems.
Headaches ahead.
4. How much effort would it take for me do write software which would
1. Send sample to EPS
Quite a bit. The EPS sys-ex implementation is flaky, and completely
unsupported by Ensoniq if you're just Joe User. I've had a really hard
time getting any reliable information out of them. For the IBM, Turtle
Beach Software's SampleVision software ($300-400, I think) is a great
sample editor that supports the EPS. Unless you love hexadecimal and
timing puzzles more than sounds, buying this ( or another ) editor is
the thing to do. Far as I know, this is the only IBM-based editor,
but I could be mistaken.
6. Is source code available for any sample-processing or Music
V-style programs?
Yes. Prentice-Hall is publishing ELEMENTS OF COMPUTER MUSIC by
F. Richard Moore, which promises to contain a lot of C code that seems]
to emulate csound and Music4+ functiions. (I haven't seen the book,
just the hype.) Csound & Music4+ code is migrating elsewhere, too.
Check the letters column in Computer Music Journal 13:3 for a couple
of examples.
From schabtac@spot.Colorado.EDU Mon Apr 30 13:53:49 1990
Received: from spot.Colorado.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA03539; Mon, 30 Apr 90 13:53:46 -0500
Received: by spot.Colorado.EDU (5.57/CU-CNS2.4-C)
id AA14312; Mon, 30 Apr 90 12:53:25 MDT
Date: Mon, 30 Apr 90 12:53:25 MDT
From: schabtac@spot.Colorado.EDU (SCHABTACH ADAM)
Message-Id: <9004301853.AA14312@spot.Colorado.EDU>
To: davisonj@en.ecn.purdue.edu, eps@VAXF.Colorado.EDU
Subject: Re: EPS MIDI sample dump -- yes or no?
Status: RO
The EPS does NOT support the MIDI Sample Dump standard.
It will transfer samples over MIDI -- you don't need the SCSI interface. Of
course, it's a bit slow. If you want to transfer samples between two
samplers, you're going to need a computer in between (e.g. a Macintosh
running Alchemy). That is, there's no way to hook an EPS and another kind
of sampler together with a MIDI cable and transfer samples between them.
As for the IBM drive question, I've never heard of it being done, but that
certainly doesn't mean it's impossible.
--Adam
From jboyd@UCSD.EDU Mon Apr 30 15:49:01 1990
Received: from ucsd.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA18818; Mon, 30 Apr 90 15:48:58 -0500
Received: from sdacs.ucsd.edu by ucsd.edu; id AA14856
sendmail 5.61/UCSD-2.0-sun via SMTP
Mon, 30 Apr 90 13:48:38 -0700 for davisonj@en.ecn.purdue.edu
Received: by sdacs.UCSD.EDU (4.0/UCSDGENERIC2)
id AA09458 for delivery to davisonj@en.ecn.purdue.edu; Mon, 30 Apr 90 13:48:35 PDT
Date: Mon, 30 Apr 90 13:48:35 PDT
From: jboyd@UCSD.EDU (John Boyd)
Message-Id: <9004302048.AA09458@sdacs.UCSD.EDU>
To: davisonj@en.ecn.purdue.edu
Subject: Re: EPS MIDI sample dump -- yes or no?
Status: RO
You can buy a program that will transfer the sample via midi,
such as Sample Vision and then store it to disk. I've also heard that
this can be done via a serial port (if one exists). I don't believe
that the EPS has a serial port as is, but there may be companies that
do make such an add on to accompany their software. The serial port
would be much quicker than midi. As far as diskette configuration
goes, I've only heard that the EPS is SIMILAR to Mac formats. If you
had the YAMAHA TX16W? then you could read directories of the sample
data on your IBM. And SampleVision does support the standard.
-john
From decwrl!lll-winken!well!csz@cs.purdue.edu Mon Apr 30 23:49:20 1990
Received: from ee.ecn.purdue.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA17050; Mon, 30 Apr 90 23:49:17 -0500
Received: from arthur.cs.purdue.edu by ee.ecn.purdue.edu (5.61/1.21jrs)
id AA22246; Mon, 30 Apr 90 23:49:11 -0500
Received: by arthur.cs.purdue.edu (5.61/PURDUE_CS-1.2)
id <AA04026@arthur.cs.purdue.edu>; Mon, 30 Apr 90 23:48:56 -0500
Received: by decwrl.dec.com; id AA11282; Mon, 30 Apr 90 21:48:15 -0700
Received: by lll-winken.llnl.gov (smail2.5)
id AA02681; 30 Apr 90 21:42:11 PDT (Mon)
Received: by well.sf.ca.us (4.12/4.7)
id AA18293; Mon, 30 Apr 90 20:59:39 pdt
Date: Mon, 30 Apr 90 20:59:39 pdt
From: decwrl!well!csz@cs.purdue.edu (Carter Scholz)
Message-Id: <9005010359.AA18293@well.sf.ca.us>
To: davisonj@en.ecn.purdue.edu
Status: RO
I can't mail to the EPS mailing list node. This is for you, anyway:
Subject: Re: Lots of Questions
1. What's the best PC-to-MIDI card available? Downward compatibility
Music Quest (800) 876-1376 or (214) 881-7408 for tech questions. Wide
range of MPU-401 compatibles, great tech support last time I checked.
2. Are there any reasonably affordable (i.e. <= $500) sound cards for
the PC? I would like to write some Music V-ish stuff on the IBM
No. Entry price for this stuff is >$1000. <$500 gives you MIDI-based
preset stuff.
3. What equipment do I need to start doing EPS sample editing on the
PC? My guess is that I would need a SCSI port on the PC, that
Wrong. You can up/download samples over MIDI. It's slow (1-2 mins for
a max-memory sample) but tolerable. Upgrading both the EPS & PC to SCSI
could go >$500 without software. The EPS has SCSI compatibility problems.
Headaches ahead.
4. How much effort would it take for me do write software which would
1. Send sample to EPS
Quite a bit. The EPS sys-ex implementation is flaky, and completely
unsupported by Ensoniq if you're just Joe User. I've had a really hard
time getting any reliable information out of them. For the IBM, Turtle
Beach Software's SampleVision software ($300-400, I think) is a great
sample editor that supports the EPS. Unless you love hexadecimal and
timing puzzles more than sounds, buying this ( or another ) editor is
the thing to do. Far as I know, this is the only IBM-based editor,
but I could be mistaken.
6. Is source code available for any sample-processing or Music
V-style programs?
Yes. Prentice-Hall is publishing ELEMENTS OF COMPUTER MUSIC by
F. Richard Moore, which promises to contain a lot of C code that seems]
to emulate csound and Music4+ functiions. (I haven't seen the book,
just the hype.) Csound & Music4+ code is migrating elsewhere, too.
Check the letters column in Computer Music Journal 13:3 for a couple
of examples.
--Carter Scholz csz@well.uucp ...!ucbvax!well!csz
From obrien@aerospace.aero.org Tue May 1 11:27:04 1990
Received: from aerospace.aero.org by en.ecn.purdue.edu (5.61/1.21jrs)
id AA06824; Tue, 1 May 90 11:27:00 -0500
Received: from antares.aero.org by aerospace.aero.org with SMTP (5.61++/6.0.GT)
id AA12288 for davisonj@en.ecn.purdue.edu; Tue, 1 May 90 09:26:24 -0700
Posted-Date: Tue, 01 May 90 09:26:17 -0700
Received: from anpiel.aero.org by antares.aero.org (4.1/SMI-3.2-A4ant)
id AA04771 for davisonj@en.ecn.purdue.edu; Tue, 1 May 90 09:26:20 PDT
Message-Id: <9005011626.AA04771@antares.aero.org>
Received: from localhost by anpiel.aero.org (4.1/SMI-3.2-A4)
id AA01724 for eps%reed.bitnet@cornellc.cit.cornell.edu; Tue, 1 May 90 09:26:18 PDT
To: davisonj@en.ecn.purdue.edu
Cc: eps%reed.bitnet@CORNELLC.cit.cornell.edu
Subject: Re: EPS MIDI sample dump -- yes or no?
In-Reply-To: Your message of "Mon, 30 Apr 90 13:26:34 CDT."
<9004301826.AA00122@en.ecn.purdue.edu>
Date: Tue, 01 May 90 09:26:17 -0700
From: Mike O'Brien <obrien@aerospace.aero.org>
Status: RO
The EPS will transmit its samples over either MIDI or SCSI. I'm afraid
I'm too ignorant to know whether or not what it transmits over MIDI corresponds
to the MIDI sample dump format. The way it works is that it gets a MIDI request
to dump, then listens on the SCSI port. If it hears any SCSI command with
the EPS address (SCSI 3) it proceeds to send the sample via SCSI, otherwise
it times out and sends it via MIDI.
From obrien@aerospace.aero.org Tue May 1 11:30:17 1990
Received: from aerospace.aero.org by en.ecn.purdue.edu (5.61/1.21jrs)
id AA07162; Tue, 1 May 90 11:30:15 -0500
Received: from antares.aero.org by aerospace.aero.org with SMTP (5.61++/6.0.GT)
id AA12493 for davisonj@en.ecn.purdue.edu; Tue, 1 May 90 09:29:34 -0700
Posted-Date: Tue, 01 May 90 09:29:26 -0700
Received: from anpiel.aero.org by antares.aero.org (4.1/SMI-3.2-A4ant)
id AA04830 for davisonj@en.ecn.purdue.edu; Tue, 1 May 90 09:29:31 PDT
Message-Id: <9005011629.AA04830@antares.aero.org>
Received: from localhost by anpiel.aero.org (4.1/SMI-3.2-A4)
id AA01739 for eps%reed.bitnet@cornellc.cit.cornell.edu; Tue, 1 May 90 09:29:28 PDT
To: davisonj@en.ecn.purdue.edu
Cc: eps%reed.bitnet@CORNELLC.cit.cornell.edu
Subject: Re: EPS MIDI sample dump -- yes or no?
In-Reply-To: Your message of "Mon, 30 Apr 90 13:26:34 CDT."
<9004301826.AA00122@en.ecn.purdue.edu>
Date: Tue, 01 May 90 09:29:26 -0700
From: Mike O'Brien <obrien@aerospace.aero.org>
Status: RO
Oh yeah about the floppies - they're DS/DD, and recorded at constant
angular velocity (i.e. IBM-style as opposed to Apple 3-speed style). Hence your
IBM drive will be able to read them as raw data. However the disk structure
is EPS-specific. A nibble-copier can be used on the IBM to copy the disks,
for example, but you won't see a DOS file structure on them.
Mike O'Brien
From sendai!@leebai.aa.ox.com:rich Tue May 1 12:37:48 1990
Received: from leebai.aa.ox.com by en.ecn.purdue.edu (5.61/1.21jrs)
id AA14138; Tue, 1 May 90 12:37:42 -0500
Received: from sendai.UUCP by leebai.aa.ox.com with UUCP
(5.61++/IDA-1.2.8) id AA11803; Tue, 1 May 90 13:39:12 -0400
Received: by sendai.ann-arbor.mi.us (4.0/smail2.5/03-15-90)
id AA03389; Tue, 1 May 90 13:23:26 EDT
Date: Tue, 1 May 90 13:23:26 EDT
From: rich@sendai.ann-arbor.mi.us (K. Richard Magill)
Message-Id: <9005011723.AA03389@sendai.ann-arbor.mi.us>
To: davisonj@en.ecn.purdue.edu
Cc: eps@cse.ogi.edu
In-Reply-To: <9004301826.AA00122@en.ecn.purdue.edu> "leebai!en.ecn.purdue.edu!davisonj"
Subject: EPS MIDI sample dump -- yes or no?
Reply-To: rich@sendai.ann-arbor.mi.us
Status: RO
Date: Mon, 30 Apr 90 13:26:34 -0500
From: leebai!en.ecn.purdue.edu!davisonj (John M Davison)
Does the EPS support the MIDI sample dump standard, or do I need to
get all that SCSI stuff in order to be able to transfer an EPS sample to
som eother machine?
Neither. The eps can dump samples, but by using sysex messages unique
to the eps.
How tough is it to make an IBM 3.5" drive understand an EPS floppy?
To my knowledge, the floppy format has not been published nor has
reverse engineering info been made public and thus it has not been
done.
From @RELAY.CS.NET,@tektronix.tek.com,@RELAY.CS.NET:microsoft!brianw@UUNET.UU.NET Thu May 3 17:34:37 1990
Received: from relay.cs.net by en.ecn.purdue.edu (5.61/1.21jrs)
id AA06914; Thu, 3 May 90 17:34:33 -0500
Received: from tektronix.tek.com by RELAY.CS.NET id aa17874; 3 May 90 10:12 EDT
Received: by tektronix.TEK.COM (5.51/7.1)
id AA25567; Thu, 3 May 90 07:16:58 PDT
Received: from by zephyr.ENS.TEK.COM (4.1/7.1)
id AB04577; Thu, 3 May 90 07:09:41 PDT
Received: from relay.cs.net by RELAY.CS.NET id ab28768; 3 May 90 9:59 EDT
Received: from uunet.uu.net by RELAY.CS.NET id aa17703; 3 May 90 10:05 EDT
Received: from microsoft.UUCP by uunet.uu.net (5.61/1.14) with UUCP
id AA24988; Thu, 3 May 90 10:04:59 -0400
From: microsoft!brianw@UUNET.UU.NET
Message-Id: <9005031404.AA24988@uunet.uu.net>
To: davisonj%en.ecn.purdue.edu@RELAY.CS.NET
Cc: tektronix!reed!eps@UUNET.UU.NET
Subject: Re: EPS MIDI sample dump -- yes or no?
Date: Mon Apr 30 14:30:58 1990
Status: RO
| Does the EPS support the MIDI sample dump standard, or do I need to
| get all that SCSI stuff in order to be able to transfer an EPS sample to
| som eother machine?
The EPS does not support the MIDI sample dump standard,
but it does support MIDI sample dumps. The SCSI stuff is
not necessary, just faster. I wrote a simple program on
my Apple ][ to get and display waveforms, and a Basic
program which creates pure sine wave samples to send to
the EPS. It works just fine over MIDI. Call Ensoniq for
the External Command Specification. The data is standard
16 bit linear samples, so transfer to another sampler is
uncomplicated.
| How tough is it to make an IBM 3.5" drive understand an EPS floppy?
I don't know, but since the Atari can copy EPS disks, I
would assume that the data could be examined on a PC with
Norton Utilities or something similar. You would need to
do some serious hacking to decipher the EPS format, but
the key would be to read in the sectors and examine the
data for different files. A hint: I was told by Alan
Smith at Ensoniq that the format is FAT (file allocation
table) based, like the PC disks, but that he didn't have
the time to explain in detail (nor did he know if Ensoniq
would approve). Unfortunately, the format is not similar
enough to allow you to just insert an EPS disk and access
it on a PC without some translation.
Brian Willoughby
From eesnyder@boulder.Colorado.EDU Fri May 4 22:26:31 1990
Received: from boulder.Colorado.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA28257; Fri, 4 May 90 22:26:29 -0500
Return-Path: <eesnyder@boulder.Colorado.EDU>
Received: by boulder.Colorado.EDU (cu-hub.890824)
Received: by beagle.colorado.edu (cu.generic.890828)
Date: Fri, 4 May 90 20:26:20 -0700
From: Eric E. Snyder <eesnyder@boulder.Colorado.EDU>
Message-Id: <9005050326.AA06853@beagle.colorado.edu>
To: davisonj@en.ecn.purdue.edu
Subject: DNA music
Cc: eesnyder@boulder.Colorado.EDU
Status: RO
I have not heard from you recently; how did your presentation go?
I sent the following re:reimbursement. The $10 was just a number off
the top of my head; the tape cost $4.75 and postage was about a dollar.
I look forward to hearing from you....
>From eesnyder Mon Apr 16 21:06 GMT 1990
Received: by beagle.colorado.edu (cu.generic.890828)
Date: Mon, 16 Apr 90 14:06:22 -0700
From: Eric E. Snyder <eesnyder>
To: davisonj@en.ecn.purdue.edu
Subject: Re: DNA music request
Cc: eesnyder
Status: R
I am glad you like the music and hope it will contribute to your
presentation. $10 for the tape and recording time would be an
appropriate reimbursement. I would also like a final draft of your
work discussing my pieces, if possible. I am interested to know
how you presented it. Will any of this be published?
Thanks again for your interest.
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder
Department of Biochemistry Proctoscopy recapitulates
University of Colorado, Boulder hagiography.
Boulder, Colorado 80309
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------
From rolnick@iear.arts.rpi.edu Sat May 5 00:36:06 1990
Received: from rpi.edu by en.ecn.purdue.edu (5.61/1.21jrs)
id AA11374; Sat, 5 May 90 00:36:03 -0500
Received: from iear.arts.rpi.edu by rpi.edu (4.1/SM45-RPI-ITS);
id AA12782; Sat, 5 May 90 01:34:46 EDT for davisonj@en.ecn.purdue.edu
Received: by iear.arts.rpi.edu (3.2/HUB10);
id AA05873; Sat, 5 May 90 01:34:52 EDT for davisonj@en.ecn.purdue.edu
Date: Sat, 5 May 90 01:34:52 EDT
From: Neil Rolnick <rolnick@iear.arts.rpi.edu>
Message-Id: <9005050534.AA05873@iear.arts.rpi.edu>
To: davisonj@en.ecn.purdue.edu
Subject: Re: oops
Status: RO
Well, I sent it to the West Lafayette address. And it came back. The $20
was because (1) I generally charge $8 to $10 for a tape when I sell it at
concerts, and (2) because I sent them express mail for $12.50
Sorry you didn't get them.
- Neil
From obrien@aerospace.aero.org Tue May 22 10:40:53 1990
Received: from aerospace.aero.org by en.ecn.purdue.edu (5.61/1.21jrs)
id AA10348; Tue, 22 May 90 10:40:50 -0500
Received: from antares.aero.org by aerospace.aero.org with SMTP (5.61++/6.0.GT)
id AA02366 for davisonj@en.ecn.purdue.edu; Tue, 22 May 90 08:40:42 -0700
Posted-Date: Tue, 22 May 90 08:40:34 -0700
Message-Id: <9005221540.AA02366@aerospace.aero.org>
Received: from anpiel.aero.org by antares.aero.org (4.1/AMS-1.0)
id AA22084 for davisonj@en.ecn.purdue.edu; Tue, 22 May 90 08:40:39 PDT
To: davisonj@en.ecn.purdue.edu
Cc: eps%reed.bitnet@cunyvm.cuny.edu
Subject: Re: Maartists 3.8 Megabyte Interconnect Expander
In-Reply-To: Your message of "Mon, 21 May 90 20:44:27 CDT."
<9005220144.AA04650@en.ecn.purdue.edu>
Date: Tue, 22 May 90 08:40:34 -0700
From: Mike O'Brien <obrien@aerospace.aero.org>
Status: RO
I just talked to Alan Smith at Ensoniq the other day, and he
confirmed that the address lines are multiplexed. Even if the Maartists
expander amounted to a giant bank switch, they'd have to hack the OS so
that all the nice little bits inside it that think they know what
instruments are loaded where could be updated.
So, either they've hacked the OS or they've cut etch on the mother
board and added some stuff. Or else it's vaporware - have they delivered
any?
Mike O'Brien
From @CORNELLC.cit.cornell.edu:vine!ksh@ames.arc.nasa.gov Tue May 22 12:33:05 1990
Received: from CORNELLC.CIT.CORNELL.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA15129; Tue, 22 May 90 12:33:02 -0500
Received: from ames.arc.nasa.gov by CORNELLC.cit.cornell.edu (IBM VM SMTP R1.2.1MX) with TCP; Tue, 22 May 90 13:32:14 EDT
Received: by ames.arc.nasa.gov (5.61/1.2); Tue, 22 May 90 10:32:56 -0700
Received: by vine.com (5.51/smail2.5/11-24-89)
id AA13685; Tue, 22 May 90 09:30:58 PDT
Date: Tue, 22 May 90 09:30:58 PDT
From: ksh@vine.com (Kent S. Harris)
Message-Id: <9005221630.AA13685@vine.com>
To: davisonj%en.ecn.purdue.edu@CORNELLC.cit.cornell.edu
Subject: Re: Maartists 3.8 Megabyte Interconnect Expander
Status: RO
I just paid about $200 for an OEX-8. It was a bit high but my
regular shop dropped Ensoniq and I had to purchase it at a place
that didn't know me.
I don't recall the byte/word resolution, but if you are comparing
apples with apples, the Ensoniq 4X memory expander is max due to
address line limitation. I'm sure the Maartists is the same size
unles they have really done some hacking.
Kent
From kja@stekt.oulu.fi Wed May 23 09:21:35 1990
Received: from funet.fi by en.ecn.purdue.edu (5.61/1.21jrs)
id AA04310; Wed, 23 May 90 09:21:26 -0500
Received: by funet.fi; id AA10249; Wed, 23 May 90 17:20:57 +0300
Received: by stekt.oulu.fi (3.2/SMI-3.2)
id AA00184; Wed, 23 May 90 17:20:28 +0200
Date: Wed, 23 May 90 17:20:28 +0200
From: kja@stekt.oulu.fi (Kari Alakuijala)
Message-Id: <9005231520.AA00184@stekt.oulu.fi>
To: davisonj@en.ecn.purdue.edu
Subject: Re: 4X expander
Cc: so-kja@funet.fi
Status: RO
The expander is made by Katronics. It is 100% compatible with the original.
I've had one and I've never experienced any compatibility problems,
unlike some people have with other expanders. It is warranteed, and if you
happen to be unsatisfied, just return it within 30 days and I'll give you
your money back. The expander module is not compatible with Maartists
8x expander (which may result in hum because of the increased power
consumption), but the price is cheaper than any competitor has and there
is no extra for mail. Just pay $295 into my account and I'll send it
right away back to you w/o extra costs.
Ok, then. If you decide to buy it, drop me a line when you've made the
transfer. I verify the arrival of value above and send the 4x expander for
Ensoniq EPS to you.
-Kari
From schabtac@spot.Colorado.EDU Fri May 25 16:32:46 1990
Received: from spot.Colorado.EDU by en.ecn.purdue.edu (5.61/1.21jrs)
id AA01269; Fri, 25 May 90 16:32:44 -0500
Received: by spot.Colorado.EDU (5.57/CU-CNS2.4-C)
id AA16167; Fri, 25 May 90 15:32:34 MDT
Date: Fri, 25 May 90 15:32:34 MDT
From: schabtac@spot.Colorado.EDU (SCHABTACH ADAM)
Message-Id: <9005252132.AA16167@spot.Colorado.EDU>
To: davisonj@en.ecn.purdue.edu, eps@REED.BITNET,
rec-music-synth@ucbvax.berkeley.edu
Subject: Re: EPS 8-output expander
Status: RO
Well, I paid list ($250) for mine, and 190/250 = 0.76, and it seems rare to
get much better than about a 20% discount on Ensoniq accessories (at least
around here), so I'd say no, it's not too much. IMHO, of course.
(Incidentally, I've been waiting for several _months_ to get mine replaced.
It turned out to be defective -- it occasionally spews out notes on unassigned
outputs. Ensoniq said yeah, they made about 200 with that little problem.
They say they'll replace it for free, but my bozo dealer seems unable to get a
new one into the store. Sigh.)
By the way, I discovered a nice little trick: when you get the OEX-8, you'll
discover they give you this dinky little cable to connect it to the EPS. It
makes little sense to me to run eight audio cables across the floor to my mixer,
so I picked up a "Joystick Extension Cable" at Radio Shack. This is a 10'
cable with DB-9 connectors (one male, one female) and sells for a few bucks.
I run it from the EPS to the OEX-8 (which sits on a shelf in my rack just
below the mixer) and run eight short patch cords from the OEX-8 to the mixer.
I suppose it could be spewing digital hash all over the place, but it doesn't
seem to be a problem.
--Adam
From microsoft!brianw@uunet.UU.NET Fri May 25 22:15:32 1990
Received: from uunet.UU.NET by en.ecn.purdue.edu (5.61/1.21jrs)
id AA15925; Fri, 25 May 90 22:15:27 -0500
Received: from microsoft.UUCP by uunet.uu.net (5.61/1.14) with UUCP
id AA04151; Fri, 25 May 90 23:15:24 -0400
From: microsoft!brianw@uunet.uu.net
Message-Id: <9005260315.AA04151@uunet.uu.net>
To: davisonj@en.ecn.purdue.edu, eps@REED.BITNET,
rec-music-synth@ucbvax.berkeley.edu
Subject: Re: EPS 8-output expander
Date: Fri May 25 20:03:54 1990
Status: RO
| (Incidentally, I've been waiting for several _months_ to get mine replaced.
| It turned out to be defective -- it occasionally spews out notes on unassigned
| outputs. Ensoniq said yeah, they made about 200 with that little problem.
| They say they'll replace it for free, but my bozo dealer seems unable to get a
| new one into the store. Sigh.)
Ensoniq may have problems with several of the
manufacturers of their parts, but they stand by their
product and offer free replacements if they are at fault.
Considering how little they charge for the products, I
think this is a good deal for the money.
| By the way, I discovered a nice little trick: when you get the OEX-8, you'll
| discover they give you this dinky little cable to connect it to the EPS. It
| makes little sense to me to run eight audio cables across the floor to my mixer,
| so I picked up a "Joystick Extension Cable" at Radio Shack. This is a 10'
| cable with DB-9 connectors (one male, one female) and sells for a few bucks.
| I run it from the EPS to the OEX-8 (which sits on a shelf in my rack just
| below the mixer) and run eight short patch cords from the OEX-8 to the mixer.
I seem to remember it mentioned in the Transoniq Hacker
that Ensoniq made the cable very short because they had
to. I don't remember the reason.
| I suppose it could be spewing digital hash all over the place, but it doesn't
| seem to be a problem.
Well, the (multiplexed) analog signal is sent to the
OEX-8 as a differential pair. So it *should* be fairly
protected from noise. I don't know how much the power
supply current would be affected by the extension. I
doubt that the OEX-8 draws much current though.
| --Adam
Brian Willoughby
From kja@stekt.oulu.fi Mon May 28 03:53:14 1990
Received: from funet.fi by en.ecn.purdue.edu (5.61/1.21jrs)
id AA15331; Mon, 28 May 90 03:52:51 -0500
Received: by funet.fi; id AA09370; Mon, 28 May 90 11:52:33 +0300
Received: by stekt.oulu.fi (3.2/SMI-3.2)
id AA28737; Mon, 28 May 90 11:51:58 +0200
Date: Mon, 28 May 90 11:51:58 +0200
From: kja@stekt.oulu.fi (Kari Alakuijala)
Message-Id: <9005280951.AA28737@stekt.oulu.fi>
To: davisonj@en.ecn.purdue.edu
Subject: Re: 4X expander
Cc: so-kja@funet.fi
Status: RO
>What brand is the expander?
It is Katronics' 4x expander for the Ensoniq EPS. Katronics is a Finnish
corporation, that is seriously involved in electronics. Katronics is
currently designing a rack module containing up to four(?) 4x expanders
for EPS...
I'll give you a warranty to go with it (and 30 days money back, if not
satisfied). I'm waiting for your e-mail letter, since I still have the
expander around...
The account # was:
Postipankki, Oulu, Finland, EUROPE
OU-11050-298
Kari Alakuijala
Atraintie 6
90550 Oulu
Finland
EUROPE
From kja@stekt.oulu.fi Mon May 28 10:33:16 1990
Received: from funet.fi by en.ecn.purdue.edu (5.61/1.21jrs)
id AA00250; Mon, 28 May 90 10:33:08 -0500
Received: by funet.fi; id AA18298; Mon, 28 May 90 18:33:00 +0300
Received: by stekt.oulu.fi (3.2/SMI-3.2)
id AA00743; Mon, 28 May 90 18:32:27 +0200
Date: Mon, 28 May 90 18:32:27 +0200
From: kja@stekt.oulu.fi (Kari Alakuijala)
Message-Id: <9005281632.AA00743@stekt.oulu.fi>
To: davisonj@en.ecn.purdue.edu
Subject: Re: 4X expander
Status: RO
REVISED INFORMATION! :-)
The prior address should be ok, but in case of difficulties:
Here is revised information directly from Postipankki Banking
Groups new leaflet of how to send the $295 into my account:
--
Please pay to our account with
POSTIPANKKI
00007 Helsinki 7, Finland
SWIFT PSPB FI HH Telex 121698 pgiro sf
Account No.
OU-11050-298 (that's my account)
-Kari
uzanne
From eesnyder@boulder.Colorado.EDU Tue Jun 19 09:39:36 1990
Received: from bank.ecn.purdue.edu by en.ecn.purdue.edu (5.61/1.22jrs)
id AA08312; Tue, 19 Jun 90 09:39:35 -0500
Received: from boulder.Colorado.EDU by bank.ecn.purdue.edu (5.61/1.22jrs)
id AA02464; Tue, 19 Jun 90 09:39:32 -0500
Return-Path: <eesnyder@boulder.Colorado.EDU>
Received: by boulder.Colorado.EDU (cu-hub.890824)
Received: by beagle.colorado.edu (cu.generic.890828)
Date: Tue, 19 Jun 90 07:39:15 -0700
From: Eric E. Snyder <eesnyder@boulder.Colorado.EDU>
Message-Id: <9006191439.AA01288@beagle.colorado.edu>
To: davisonj@ecn.purdue.edu
Subject: Re: John Davison
Newsgroups: rec.music.synth,comp.music,alt.emusic
In-Reply-To: <1990Jun18.214742.133@ecn.purdue.edu>
References: <22359@boulder.Colorado.EDU>
Organization: University of Colorado, Boulder
Cc:
Status: RO
In article <1990Jun18.220207.674@ecn.purdue.edu> davisonj@ecn.purdue.edu (John M Davison) writes:
>In article <22359@boulder.Colorado.EDU> eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes:
>>I. The communication abruptly ends when I mention payment for the tape
>>I sent him.
>
> That's a load of shit, Eric, and you know it. I sent you a
>number of subsequent messages, but it's not my fault that you didn't
>save the messages....
Well, perhaps it is better stated that it is not your fault that I did
not *get* those subsequent messages.
John has set met a list of circumstances which detail why he has been unable
to respond to my mail.... fair enough, these reasons probably also explain
why I did not receive the letters to which he alludes.
I hope John and the net.people at large can understand my situation: it is
easy to come to the conclusion you have been ripped off when two months pass
without email or US mail containing the check for the agreed upon amount.
This was even more disturbing when I could finger davisonj and find him
logged on regularly and according to his .project, he was getting his mail.
So, if what John says is true, there is yet another thing to worry about
in network transactions: net mail is not always a reliable medium.
Misunderstandings can (apparently) arise due to poor communications.
I think everyone will agree that two months is ample time to drop a
$10 check in the mail. However, when I get said check, I offer John
my sincerest apologies for bringing this matter to public attention (and
for the little reminders I had mailed automatically from my .login).
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder
Department of Biochemistry Proctoscopy recapitulates
University of Colorado, Boulder hagiography.
Boulder, Colorado 80309-0215
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------
From curt@dtix.dt.navy.mil Tue Jun 19 14:35:16 1990
Received: from dtix.dt.navy.mil by en.ecn.purdue.edu (5.61/1.22jrs)
id AA25700; Tue, 19 Jun 90 14:34:55 -0500
Received: by dtix.dt.navy.mil (5.59/dtix.dt.navy.mil)
id AA02651; Tue, 19 Jun 90 11:52:33 EDT
Date: Tue, 19 Jun 90 11:52:33 EDT
Message-Id: <9006191552.AA02651@dtix.dt.navy.mil>
Newsgroups: rec.music.synth,comp.music,alt.exotic-music
References: <22359@boulder.Colorado.EDU>
From: curt@dtix.dt.navy.mil (Curt Welch)
Subject: Re: John Davison
To: eesnyder@boulder.Colorado.EDU (Eric E. Snyder),
davisonj@en.ecn.purdue.edu (John M Davison)
Cc: curt@dtix.dt.navy.mil
Status: RO
In article <22359@boulder.Colorado.EDU> eesnyder@boulder.Colorado.EDU
(Eric E. Snyder) writes:
>I have been avoiding voicing this matter publicly but, like the previous
>poster, I feel somewhat dismayed at how certain people can abuse the
>anonymity of the net.
Eric:
After reading your posting, I can only conclude that John did not abuse
the net. You did.
If you expected to get paid for your tape, you should have discussed the
price before sending it. You're lucky that John was willing to pay you
anything. He was giving you free publicity. You should have paid him.
At most, you should expect John to pay for the cost of the tape and postage
which should be about 5 dollars. And you should only expect him to send
that if you made it clear an advance. If you send someone something
without discussing price, then you shouldn't expect anything in return.
If they send you a thank-you note, then you should be happy. If they send
you 5 dollars, then you are allowed to think of them as a very considerate
person.
How would you like it if I sent you an invoice for $50.00 for consulting
services for writing this letter and then bad mouthed you to the net for
not paying? After all, you did ask for this by posting your article.
Curt Welch
curt@dtix.dt.navy.mil
-----END-CUT--------------------------------------------------------------------
Next is the outline that I used:
-----CUT-HERE-------------------------------------------------------------------
I. Timbral evolution (sound engines)
A. Interesting to note that in this area, analog electronics were
very far ahead of what computers could do.
B. Max V. Mathews "the father of computer-generated sound"
1. Music I (1957)
a. The first generalized computer-generated music program
b. Created at Bell Labs using an IBM 704 computer at the
IBM World Headquarters on Madison Avenue
c. D/A converter was at Bell Labs...a 12-bit vacuum tube
converter by a company called Epsco
d. Generated an equilateral triangle waveform, same rise
and decay characteristics in the envelope; pitch,
amplitude, and duration controllable...that's it!
e. Newman Guttman (a psychologist) made one composition
2. Music II (1958)
a. Capable of four independent voices, and a choice of 16
waveforms stored in memory
b. Done on the IBM 7094
3. Music III (1960) -- MAJOR conceptual advance in computer music
a. Introduced the concept of the unit generator, which
corresponded to the modules in modular synthesizers,
which came out a few years later.
Mathews:
"I wanted to give the musician a great deal of
power and generality in making the musical sounds but
at the same time I wanted as simple a program as
possible; I wanted the complexity of the program to
vary with the complexity of the musician's desires.
If the musicial wanted to do something simple, he
or she shouldn't have to very much in order to achieve
it. If the musician wanted something very elaborate
there was the option of working harder to do the
elaborate thing. The only ansewer I could see was not
to make the instruments myself -- not to impose my
taste and ideas about instruments on the
musicians -- but rather to make a set of fairly
universal building blocks and give the musician both
the task and the freedom to put these together into
his or her instruments. I made my building blocks
correspond to many of the functions of the new analog
synthesizers.
"I wouldn't say that I copied the analog
synthesizer building blocks; I think we actually
developed them fairly simultaneously. In any case,
that was an advantage because a musician who knew how
to patch together Moog synthesizer units would have
a pretty good idea how to put together unit generators
in the computer."
4. Music IV (1963)
a. Used a more advanced assembler -- one with MACRO
facilities! Written primarily because they weren't
working with the IBM 7094 anymore
b. Other universities, namely Princeton, began to mimic
Music IV with programs like Music IVB and Music IVBF
5. Music V (mid '60s)
a. written in FORTRAN -- first truly portable program
b. lots of composers used this one. Music V is the model
that programmers _still_ look to to do their stuff.
Its spirit can be found, for example, in CSound.
C. Other Methods of Synthesis
1. Additive
a. EXAMPLE -- Wendy Carlos "Digital Moonscapes"
2. FM
a. invented by John M. Chowning at Stanford University in
1973
b. Involves frequency modulation of one waveform with another
(Bessel function theory)
c. Yamaha synthesizers
d. EXAMPLE -- Martin Brody
"Moments Musicaux" (1981)
for Piano and Computer
David Evans, piano
3. Granular Synthesis
a. Sound granules, approx. 10-50 ms long
b. History:
In a 1966 article called "The liberation of
Sound," Edgard Varese wrote of a musical style
involving "the movement of sound masses, of shifting
planes," so that "in the moving masses you would be
conscious of their transmutation when they pass over
certain layers, when they penetrate certain opacities,
or are dilated into certrain rarefactions"
"Granular synthesis of sound involves
generating thousands of very short sonic grains to
form larger acoustic events...
According to an acoustical theory put forth by
Gabor (1947), a granular or quantum representation
could describe any sound. This conjecture was
verified mathematically by Bastiaans (1980). To
generate even a fairly simple sound, however, requires
a massive amount of control data, in the form of
parameters for each of the grains. If n is the number
of parameters of each grain and d is the mean grain
density (per minute), it takes d * n parameter values
to specify one minute of sound. Since d is often in
the range 1,000-5,000, it is clear that for the
purpose of computational control a higher-level unit
of organization for the grains is necessary"
Xenakis said that "All sound is an integration
of grains, of elementary sonic particles, of sonic
quanta. ...All osund, even continuous musical
variation, is conceived as an assemblage of a large
number of elementary sounds adequately disposed in
time. In the attack, body, and decline of a complex
sound, thousands of pure sounds appear in a more or
less short interval of time 'delta' t.... If we
consider the duration 'delta' t of the grain as quite
small but invariable, we can ignore it in what follows
and consider frequency and intensity only" (1971).
c. stochastic process -- randomness used to animate
timbre. The computer is perfectly suited for this
grunt-work.
d. EXAMPLE -- Curtis Roads "Field" (1981) (3:10 - 3:16)
4. Sampling --> Processing
a. Start with "sound source," then modify it extensively
to produce a palette of useful timbres.
b. synthesizers (D-50, SY77)
c. EXAMPLE -- Chris Penrose ("CircusCircus," "Lesion")
(I). 0"-40" time varying filtering applied to
string quartet
(II). 27" time expanded vocal sound (sounds like
a sheep)
50"-2'40"
d. EXAMPLE -- John Lunn "Echoes" (1980)
for Piano and Computer
John Lunn, piano
(I). Brass, bells, strings
II. Performance Interfaces (controllers)
A. Percussion controller
1. EXAMPLE -- Michael Shrieve and David Beal
_The_Big_Picture_: "The Big Picture"
B. Wind controller
1. EXAMPLE -- Yamaha soundpage (Wind controller)
C. AirDrums
1. EXAMPLE -- Neil Rolnick "Macedonian Airdrums"
D. Sensor Frame
1. Videoharp
2. EXAMPLE -- VideoHarp promotional videotape
E. Biofeedback (David Rosenboom)
1. See first column on page 65 of latest CMJ
2. EXAMPLE -- "On Being Invisible"
F. Knapp & Lusted's Biomuse
1. Rainer Maria Rilke, 1919 (latest CMJ -- see Knapp & Lusted)
2. Adrian and Mathews, 1934 (see CMJ reference on p. 65)
3. Increasingly used with the handicapped and disabled
G. Theater and Ballet
1. Flying Karamazov Brothers
a. Use a variety of sensors to create MIDI signals which
create music that is coordinated with their acrobatics
IV. Composition methods
A. Lejaren Hiller (HPSCHD) had made some compositional algorithms
back around the time that Music I was writtem (1957)
B. Use of sequencers to play the "unplayable"
1. EXAMPLE -- Frank Zappa "Black Page No. 1"
C. Reevalution of compositional process
1. Tristan Murail (1984) -- "Why speak anymore of music in
terms of notes? ...Why distinguish the notion of harmony
from that of timbre? ...Why divide the frequency space
into octaves, and then each octave into twelve?"
2. EXAMPLE -- Curtis Roads "Field"
D. Stochastic Processes/Indeterminacy in Music
1. A new way of looking at the role of composition -- instead
of looking at the composer as a generator of notes, the
composer becomes instead one who "corrals" notes.
2. Roots in Mozart's Musical Dice, musique concrete, John
Cage's chance music
3. Ideal for the computer because chance music is often
formula music; once the formula is worked out, the rest
becomes grunt work. Getting the computer to do the grunt
work makes this style of composition a viable one instead
of one that is merely fun to talk about.
4. Two possibilities: deterministic processes (like the DNA
music) and nondeterministic processes (like Rosenboom's
biofeedback, Cage, dice)
a. Freff -- "Artists tell the universe what it means"
b. "Randomness, like beauty, is in the eye of the
beholder" -- it is the task of the composer to
intelligently interpret these data
c. The compositional achievement is the imposition of a
new order on data that are arbitrarily represented;
the task of the composer is to strip off the trite,
unnecessarily associated aspects of the data (i.e.
removing the medium from the message) while imposing
his/her (composed) structure on the data; if this is
done correctly the data are freed of the
connotations inherent in the original presentation of
the data, and instead the data can either take on a
life of their own or be completely subservient to the
composer's wishes (the composer has this degree of
control)
d. In this sense, then, the artist is telling these data
what they mean, finding purpose where there isn't
any
5. Iannis Xenakis {text follows}
a. Introduced the term "stochastic" into music in 1955
with his piece _Stochastic_Music_.
b. Saw two problems in serial music
(I) Serial manipulations are nothing but particular
cases in the vast domain of combinatorial
analysis.
(II) "Upon audition, the enormous complexity prevents
one from following the tangle of lines, and has
as macroscopic effect an unreasoned and
fortuitous dispersion of sounds in the whole
sound spectrum."
c. Developed means to attempt to control the macroscopic
effect
(I) "The macroscopic effect could thus be controlled
by the mean of the motions of the n objects
chosen by us. Hence follows the introduction of
the idea of probability, which again implies
combinatorial analysis in this precise case"
d. "This introduces the concept of overall control of
complex sound events rather than their analytic and
mechanistic elaboration, exactly as in science, where
statistical methods are a tool for the overall
prehension of exceedingly complex phenomena."
e. Strikes a medium between the metaphysical randomness
promoted by Cage and the exactness favored by tradition.
f. SML (Stochastic Music Language) -- developed as a
means to create musical scores and/or performances
incorporating stochastic processes
g. EXAMPLE -- Iannis Xenakis "Eonta"
(I). Piano solo composed using IBM 7090!
6. Algorithmic Composition (Nondeterministic Processes)
a. "M" by Mark of the Unicorn...or was it Jam Factory?
b. EXAMPLE -- Jan Hammer "Scenes from Miami Vice"
c. Rosenboom (nondeterministic example)
(I). His restrictions: a very complicated system!
7. Deterministic Processes
a. EXAMPLE -- Eric E. Snyder "DNA Music"
(I). Restriction #1: his system (hardware)
(II). Restriction #2: event-oriented editing (1/f,
etc.) is his own expression.
(III). Note that it sounds a lot like "Scenes from
Miami Vice," implying that the algorithm
expresses more of itself than the data is it
supposed to process!
b. EXAMPLE -- Hiller and Cage "HPSCHD"
(I). Info:
_HPSCHD_ was so named because the
operating system on the machine on ehich _HPSCHD_
was composed had a file management system that
permitted file names with a maximum of 6
characters. (Was this a PDP?)
"..._HPSCHD_ is a gigantic multi-media spectacle.
_HPSCHD_ involved three sets of computer programs,
one for composing the tape parts and realizing
them in sound by means of digital-to-analog
conversion, the second for composing harpsichord
parts derived from Mozart's _Musical_Dice_Game_,
and the third for creating a performance part for
the high-fidelity enthusiast sitting at home
listening to the collage we prepared for a
commercial phonograph recording. Contrary to what
many critics thought (Will they ever learn?), this
was not a chaotic piece. The basic note generator
was a subroutine called ICHING that recreated the
Oracle of the _Book_of_Changes_. The results of
subroutine ICHING were not haphazard, but were
based on a polynomial distribution. Also, much of
the programming was concerned with melodic
constructions that Cage hoped express his
admiration for the melodic writing of Mozart"
(Hiller 1981, TMM p. 75).
-----END-CUT--------------------------------------------------------------------
Next is the outline that I passed to the audience:
-----CUT-HERE-------------------------------------------------------------------
I. Timbral evolution (sound engines)
A. Max V. Mathews "the father of computer-generated sound"
1. Music I (1957)
2. Music II (1958)
3. Music III (1960) -- MAJOR conceptual advance in computer music
4. Music IV (1963)
5. Music V (mid '60s)
B. Some Methods of Synthesis
1. Additive
a. EXAMPLE -- Wendy Carlos "Digital Moonscapes"
2. FM
a. EXAMPLE -- Martin Brody
"Moments Musicaux" (1981)
for Piano and Computer
David Evans, piano
3. Granular Synthesis {first implemented using Music V}
a. EXAMPLE -- Curtis Roads "Field" (1981) (3:10 - 3:16)
4. Sampling --> Processing
a. EXAMPLE -- Chris Penrose ("CircusCircus," "Lesion")
(I). 0"-40" time varying filtering applied to
string quartet
(II). 27" time expanded vocal sound (sounds like
a sheep)
50"-2'40"
b. EXAMPLE -- John Lunn "Echoes" (1980)
for Piano and Computer
John Lunn, piano
(I). Brass, bells, strings
II. Performance Interfaces (controllers)
A. Percussion Controller
1. EXAMPLE -- Michael Shrieve and David Beal
_The_Big_Picture_: "The Big Picture"
B. Breath Controller / Wind controllers
1. EXAMPLE -- Yamaha soundpage (Wind controller)
C. AirDrums
1. EXAMPLE -- Neil Rolnick "Macedonian Airdrums"
D. VideoHarp (sensor frame)
1. EXAMPLE -- promotional videotape
E. Knapp & Lusted's Biomuse
F. Biofeedback (David Rosenboom)
1. EXAMPLE -- On Being Invisible
III. Composition methods
A. Lejaren Hiller (HPSCHD) had made some compositional algorithms
back around the time that Music I was writtem (1957)
B. Use of sequencers to play the "unplayable"
a. EXAMPLE -- Frank Zappa "Black Page No. 1"
C. Stochastic Processes/Indeterminacy in Music
1. Deterministic Processes
a. EXAMPLE -- Xenakis "Eonta"
b. EXAMPLE -- Jan Hammer "Scenes from Miami Vice"
c. EXAMPLE -- Eric E. Snyder "DNA Music"
d. EXAMPLE -- Hiller and Cage "HPSCHD"
-----END-CUT--------------------------------------------------------------------
-davisonj@en.ecn.purdue.edu