[sci.med.aids] Why AZT is so expensive

eesnyder@ncar.UCAR.EDU (Eric E. Snyder) (09/20/89)

In article <929@paperboy.OSF.ORG> coren@osf.org writes:
>
>I think there's a tendency to forget what the "ID" in "AIDS" stands
>for. It isn't "the virus" (if there is indeed such a thing) that kills
>you; it's the things that get you because your immune system isn't
>functioning. Does AZT do anything directly for the immune system?

Think about it.  The reason "your" immune system is not functioning is 
because there are all these little HIVs reproducing in your precious little
CD4+ lymphocytes and killing a great many of them in the process.  AZT
stops viral reproduction by interfering with RNA-dependent DNA polymerase
(AKA reverse transcrpitase) a la di-deoxy sequening. Although the HIV pro-
virus can very well be lurking in stem cells, stop it replicating and
T4 lymphs should start coming back.... unless you are really in a bad way.

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                             I love this mansion,
Department of Biochemistry                 'though it's too many windows
University of Colorado, Boulder            to open half-way each morning
Boulder, Colorado 80309                    to close half-way each night.
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------