dd@beta.lanl.gov (Dan Davison) (07/04/89)
I need a reference to any study of how many times one needs to sequence
a given template to reduce (or eliminate) the error level as much as possible.
When sequencing first came out in preprint form ('76, '77 or
thereabouts) I do recall this subject being discussed a great deal. I
just don't remember any publications on the subject now.
The general idea is that even if your gels are clean, banding perfect,
and all those other unlikely things, the chemical and dideoxy methods
will have a certain error rate. This is generally, but not entirely,
due to misincorporation of the ddNTPs by the Klenow or other polymerase
(for the dideoxy method) or random non-specific cleavage (chemical
method).
The usual thing is to sequence both strands and pray, but I'm interested
in studies of the problem.
TIA,
dan davison/theoretical biology/t-10 ms k710/los alamos national laboratory
los alamos, nm 875545/dd@lanl.gov (arpa)/dd@lanl.uucp(new)/..cmcl2!lanl!dd
--
dan davison/theoretical biology/t-10 ms k710/los alamos national laboratory
los alamos, nm 875545/dd@lanl.gov (arpa)/dd@lanl.uucp(new)/..cmcl2!lanl!ddeesnyder@boulder.Colorado.EDU (Eric E. Snyder) (07/04/89)
In article <27540@beta.lanl.gov> dd@beta.lanl.gov (Dan Davison) writes: > >The general idea is that even if your gels are clean, banding perfect, >and all those other unlikely things, the chemical and dideoxy methods >will have a certain error rate. This is generally, but not entirely, >due to misincorporation of the ddNTPs by the Klenow or other polymerase >(for the dideoxy method) or random non-specific cleavage (chemical >method). I think errors in sequencing are more often the result of errors made prior to the actual sequencing reaction. Even if the ddNTP method randomly misincorporates at a certain frequency, it is usually easy to see the ambiguity because, say lane A has a band and so does G, you know you have a problem. A more serious problem lies in cDNA clones which rely on reverse transcriptase (a notoriously sloppy enzyme). If the clone you pick from your library happens to have a "miscopied" base, your sequencing reactions will be clear as day and there will still be a mistake in the sequence. The became painfully clear to us when we found a stop codon right in the middle of our longest clone of human beta-casein. We were already comming up with theories on suppressor tRNA's in mammary tissue before we sequenced other clones and realized it was just a glitch from reverse transcriptase. With the growing popularity of PCR, I am sure a lot of people are going to get stung due to the high error rate of Taq polymerase (misincorportation rate about 1 in 1000 bases). ------------------------------------------------------------------------- AAGGTGCAATGATGAGGAATTTTATCGTAGTTATGAATAATCCTGCAAGAGGTGCAAAACCCAGAGTACCTCA Eric E. Snyder Department of Molecular, I thought it was rain for a minute; Cellular and Developmental Biology I thought the game had been called. University of Colorado, Boulder TTCCACGTTACTACTCCTTAAAATAGCATCAATACTTATTAGGACGTTCTCCACGTTTTGGGTCTCATGGAGT -------------------------------------------------------------------------