eesnyder@ncar.UCAR.EDU (Eric E. Snyder) (09/20/89)
In article <929@paperboy.OSF.ORG> coren@osf.org writes: > >I think there's a tendency to forget what the "ID" in "AIDS" stands >for. It isn't "the virus" (if there is indeed such a thing) that kills >you; it's the things that get you because your immune system isn't >functioning. Does AZT do anything directly for the immune system? Think about it. The reason "your" immune system is not functioning is because there are all these little HIVs reproducing in your precious little CD4+ lymphocytes and killing a great many of them in the process. AZT stops viral reproduction by interfering with RNA-dependent DNA polymerase (AKA reverse transcrpitase) a la di-deoxy sequening. Although the HIV pro- virus can very well be lurking in stem cells, stop it replicating and T4 lymphs should start coming back.... unless you are really in a bad way. --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder I love this mansion, Department of Biochemistry 'though it's too many windows University of Colorado, Boulder to open half-way each morning Boulder, Colorado 80309 to close half-way each night. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------